User: Konstantinos Yeles

Reputation:
40
Status:
New User
Location:
Italy/Salerno
Last seen:
1 day, 19 hours ago
Joined:
7 months ago
Email:
y*****************@gmail.com

Posts by Konstantinos Yeles

<prev • 14 results • page 1 of 2 • next >
0
votes
1
answer
107
views
1
answers
Comment: C: RIP-seq identifing reverse complement reads between smallRNA and targeted mRNA
... Then I could use R to subset the BED and then use it with bed tools Thanks. Is it possible to post it as an answer? ...
written 9 days ago by Konstantinos Yeles40
0
votes
1
answer
107
views
1
answers
Comment: C: RIP-seq identifing reverse complement reads between smallRNA and targeted mRNA
... I have reads from a BAM file of length <45 and reads 45< rl < 80. I have aligned them and now I'm looking to check if between these sets there is a matching. ...
written 9 days ago by Konstantinos Yeles40
6
votes
1
answer
107
views
5 follow
1
answer
RIP-seq identifing reverse complement reads between smallRNA and targeted mRNA
... Dear Biostars, I want to find a way to search for reads that have reverse complements inside a library from a RIP-seq experiment. I have found this related question: [Question: Finding complementarity between mRNA and rRNA using BLAST][1] but nucleotide blast seems to be a bit different now. Current ...
R smallrna genomicranges rip-seq written 9 days ago by Konstantinos Yeles40 • updated 8 days ago by shawn.w.foley420
0
votes
1
answer
124
views
1
answers
Comment: C: How to convert output from bowtie1 to Genomic ranges
... I tried the bowtie2sam.pl and got : Argument "IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII" isn't numeric in numeric eq (==) at ~/bowtie2sam.pl line 70, <> line 861046. Argument "chr1" isn't numeric in addition (+) at ~/bowtie2sam.pl line 67, <> line 861047. and then with samtools: ...
written 10 weeks ago by Konstantinos Yeles40
0
votes
1
answer
124
views
1
answers
Comment: C: How to convert output from bowtie1 to Genomic ranges
... I would have done that but that output is a part of a workflow of a tool I use. ...
written 10 weeks ago by Konstantinos Yeles40
1
vote
1
answer
124
views
1
answer
How to convert output from bowtie1 to Genomic ranges
... Hello, I have output from bowtie 1 bowtie '~/UCSC/hg38/Sequence/BowtieIndex/genome' -f '~/sample.fa' -v 1 -k 1 -p 6 --al outputAligned --un outputNotAligned > randomtest1 that it looks like that: fread("randomtest1") V1 V2 V3 V4 V5 ...
genomicranges rna-seq bowtie written 10 weeks ago by Konstantinos Yeles40 • updated 10 weeks ago by ATpoint15k
0
votes
2
answers
439
views
2
answers
Comment: C: smallRNA sequencing workflow and Database usage
... Yes, I'm aware of this publication. Currently, I'm following a workflow using the databases but I'll try to follow the suggestions you proposed to use another workflow without the databases. Happy New Year! ...
written 3 months ago by Konstantinos Yeles40
0
votes
3
answers
349
views
3
answers
Comment: C: Normalization for small non-coding RNA (piRNAs)
... Thank you again for the detailed answer. Is it possible to extend a bit the part of > map the small RNA to the genome For example: - Bowtie with 1 mismatch and no multi-mapping - apply featureCounts or summarizeOverlaps or tximport to count all small-RNAs (using specific libraries or some ...
written 4 months ago by Konstantinos Yeles40
0
votes
3
answers
349
views
3
answers
Comment: C: Normalization for small non-coding RNA (piRNAs)
... Dear António Miguel de Jesus Domingues, thank you for the detailed answer! I will focus on the second part of the answer as it seems that I do not have a correct mapping of reads(regarding small RNAdbs) and it's a core problem. read TGCCAAACTAAGCAAGGTCACGTGTGAA has a full match with piR-51200 and ...
written 4 months ago by Konstantinos Yeles40
0
votes
3
answers
349
views
3
answers
Comment: C: Normalization for small non-coding RNA (piRNAs)
... Well, the first question is "Are piRNAs expressed in these cell lines? If yes, could we check the relative expression in treated/untreated?". There are also other conditions but I cannot report them now. ...
written 4 months ago by Konstantinos Yeles40

Latest awards to Konstantinos Yeles

Supporter 4 months ago, voted at least 25 times.
Student 5 months ago, asked a question with at least 3 up-votes. For smallRNA sequencing workflow and Database usage

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1579 users visited in the last hour