User: catechize.2.learn

Reputation:
120
Status:
Trusted
Location:
Last seen:
3 months, 1 week ago
Joined:
1 year, 7 months ago
Email:
c****************@gmail.com

Posts by catechize.2.learn

<prev • 26 results • page 1 of 3 • next >
1
vote
2
answers
2.3k
views
2
answers
Answer: A: how to correct gene expression based on tumor purity
... Hi, You may look at this article: contamDE-lm: linear model-based differential gene expression analysis using next-generation RNA-seq data from contaminated tumor samples https://academic.oup.com/bioinformatics/advance-article-abstract/doi/10.1093/bioinformatics/btaa006/5698700 ...
written 3 months ago by catechize.2.learn120
2
votes
1
answer
557
views
1
answers
Comment: C: Meta-analysis on microaray data, when a sinlge experiment contains diferent tiss
... Jut installed chrome and the functionality was restored in my original browser (palemoon). ...
written 8 months ago by catechize.2.learn120
1
vote
1
answer
557
views
1
answers
Comment: C: Meta-analysis on microaray data, when a sinlge experiment contains diferent tiss
... ![enter image description here][1] OS= Win 7 **update:** Jut installed chrome and the functionality was restored in my *original browser* (palemoon). [1]: https://i.ibb.co/02mmWwc/Untitled.png ...
written 8 months ago by catechize.2.learn120
0
votes
1
answer
557
views
1
answers
Comment: C: Meta-analysis on microaray data, when a sinlge experiment contains diferent tiss
... Chrome is available to me but makes my laptop sluggish. FYI I also used Slimjet (also based on blink) on win 7 and Chrome and opera mini beta (the latter two on android) with no success. ...
written 8 months ago by catechize.2.learn120
0
votes
1
answer
557
views
1
answers
Comment: C: Meta-analysis on microaray data, when a sinlge experiment contains diferent tiss
... Thanks genomax. I used to see and use the buttons and that is why I apologized. I tried Firefox 69 and Palemoon 27 (my default browser which used to show the stuff) neither showing the buttons for *answers* but showing upvote button for comments. ...
written 8 months ago by catechize.2.learn120
0
votes
1
answer
557
views
1
answers
Comment: C: Meta-analysis on microaray data, when a sinlge experiment contains diferent tiss
... Thank you indeed very much. Is there a quantitative measure in common use for such situations? Another question as you are a moderator of biostars, why there is no upvote or accept buttons (for your post/for my profile) so that I can thank in that way and others benefit from the post? ...
written 8 months ago by catechize.2.learn120
5
votes
1
answer
557
views
1
answer
Meta-analysis on microaray data, when a sinlge experiment contains diferent tissues
... Hi! I dont know whether this is the best place to ask this question, however: Suppose I want to perform meta-analysis on 10 different microarray studies. Study Tissue/source Study1 Neuron Study2 Blood Study3 Neuron and PBMC ...... ..... Study10 ... ...
meta-analysis microarray written 8 months ago by catechize.2.learn120 • updated 8 months ago by Kevin Blighe60k
0
votes
0
answers
220
views
0
answers
Mapping a list of sequences to gene symbol
... Hi! I have a list of sequences majority of which map to human genome. I want to map them onto the genome, and obtain gene symbol when the sequence falls within a gene. I already know of an R solution which seems very slow on running, a solution based on Blat which I honestly dont know and dont hav ...
stringtie salmon htseqcount hisat2 written 10 months ago by catechize.2.learn120
0
votes
0
answers
70
views
0
answers
Comment: C: List of sequences to gene symbol
... Thank you @genomax. ...
written 10 months ago by catechize.2.learn120
0
votes
0
answers
70
views
0
answers
Comment: C: List of sequences to gene symbol
... loop over probes; loop over chromosome matchPattern > create Grange > genes [finOverlaps with genes from TxDb.Hsapiens.UCSC.hg19.knownGene] > find symbol > break chromosome loop Probes contain: GAGATAACTAGAACAGTGTCCCTCCCCTTTTATAACCTGTGTTTTTAGATTTCAAAAAGA CTAACTGTCAAACAAAGATGGG ...
written 10 months ago by catechize.2.learn120

Latest awards to catechize.2.learn

Popular Question 7 months ago, created a question with more than 1,000 views. For Determination of hub genes in PPI network

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 853 users visited in the last hour