User: BioBaby

gravatar for BioBaby
BioBaby0
Reputation:
0
Status:
New User
Last seen:
1 week, 3 days ago
Joined:
7 months, 2 weeks ago
Email:
m**************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by BioBaby

<prev • 25 results • page 1 of 3 • next >
0
votes
0
answers
146
views
0
answers
Comment: C: MDS Plot R
... yes...i am having 16 sample with 3 replicates....whenever you get time please tell me how to deal with this. ...
written 19 days ago by BioBaby0
0
votes
0
answers
146
views
0
answers
Comment: C: MDS Plot R
... thanks kevin...it works....can you tell me how to give 16 different color......if I am giving by this way ...it goes to new line then it is error. plotMDS(y,h,col=c(rep("red",3),rep("blue",3),rep("green",3), rep("black",3), rep("brown",3),rep("cyan",3),rep("yellow",3),rep("pink",3),rep("gray", ...
written 19 days ago by BioBaby0
0
votes
0
answers
146
views
0
answers
Comment: C: MDS Plot R
... now I got output...thanks Kevin....now I want to mention that which sample representing which color (legend)....after above code I am giving this code: legend("topleft", legend=c("a", "b","c","d"), pch=19,col=c(rep("red",3),rep("blue",3),rep("green",3), rep("black",3))) but it is giving "a", ...
written 19 days ago by BioBaby0
0
votes
0
answers
146
views
0
answers
Comment: C: MDS Plot R
... no R plot window open even at local OS......no message came after running plotMDS()...Outfile generate but it is 0 kb. ...
written 21 days ago by BioBaby0
0
votes
0
answers
146
views
0
answers
Comment: C: MDS Plot R
... no i did not use dev.off().....yes I am using server which give mds plot very late but I got after 6-8 hrs. i already got mds plot with column name itself but i want to define column by specific color and I try this code. but no output even after one day. ...
written 21 days ago by BioBaby0
0
votes
0
answers
146
views
0
answers
Comment: C: MDS Plot R
... i did not generate plot ...
written 21 days ago by BioBaby0
1
vote
0
answers
146
views
0
answers
MDS Plot R
... Hi, I am new to R and need to generate MDS plot for 4 different sample with 3 replicates each, indicate with four different color (replicate should have color).I tried this code: library("limma") library("edgeR") library("ggplot2") x <- read.delim("IR_all",row.names="gene") ...
rna-seq written 21 days ago by BioBaby0
0
votes
1
answer
218
views
1
answers
Comment: C: count file zero
... I tried by -O parameter of featureCount still did not work. and 211 is length of transcript..can I create count file from idxstats output? it will be OK for further differential gene expression analysis? ...
written 5 months ago by BioBaby0
0
votes
0
answers
321
views
0
answers
Comment: C: count file having zero
... thanks for giving your time Ryan...one question I have..can I create count file from idxstats output? it will be OK for further differential gene expression analysis? ...
written 5 months ago by BioBaby0
0
votes
1
answer
218
views
1
answers
Comment: C: count file zero
... As above I showed GTF that is manually created from idxstat file only sir still it did not give.... I changed my database also: >SL3.0ch00 GCCTATATATAGAGTACTAAATTCCTTAAAAAGGCATCTCGGAAGTTCCATAAATAGATCAAGATATCGAATAATATACAAATTGAT >SL3.0ch00 GGATTATTCATAGAGAGAGGTCAAATGTAAATCATCCTA ...
written 5 months ago by BioBaby0

Latest awards to BioBaby

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 938 users visited in the last hour