User: BioBaby

gravatar for BioBaby
BioBaby0
Reputation:
0
Status:
New User
Last seen:
11 hours ago
Joined:
2 months, 2 weeks ago
Email:
m**************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by BioBaby

<prev • 18 results • page 1 of 2 • next >
0
votes
1
answer
106
views
1
answers
Comment: C: count file zero
... I tried by -O parameter of featureCount still did not work. and 211 is length of transcript..can I create count file from idxstats output? it will be OK for further differential gene expression analysis? ...
written 10 days ago by BioBaby0
0
votes
0
answers
170
views
0
answers
Comment: C: count file having zero
... thanks for giving your time Ryan...one question I have..can I create count file from idxstats output? it will be OK for further differential gene expression analysis? ...
written 10 days ago by BioBaby0
0
votes
1
answer
106
views
1
answers
Comment: C: count file zero
... As above I showed GTF that is manually created from idxstat file only sir still it did not give.... I changed my database also: >SL3.0ch00 GCCTATATATAGAGTACTAAATTCCTTAAAAAGGCATCTCGGAAGTTCCATAAATAGATCAAGATATCGAATAATATACAAATTGAT >SL3.0ch00 GGATTATTCATAGAGAGAGGTCAAATGTAAATCATCCTA ...
written 11 days ago by BioBaby0
0
votes
1
answer
106
views
1
answers
Comment: C: count file zero
... sorry for not clear but they are real examples only. ...
written 11 days ago by BioBaby0
0
votes
1
answer
106
views
1
answers
Comment: C: count file zero
... yes...but what about SL3.0ch00:1150608-1151254 646 4 0 SL3.0ch00:4197332-4197641 309 6290 0 SL3.0ch00:4197715-4198037 322 14021 0 ?? ...
written 11 days ago by BioBaby0
1
vote
1
answer
106
views
1
answer
count file zero
... hello everyone, I identified some lincRNA from different light treatment and tissue specific data.Now I want to see differential expression of these lincRNA among these tissue and light specific data so for that I align individual raw read (tissue and light specific) to these lincRNA(predicted) the ...
next-gen alignment rna-seq written 11 days ago by BioBaby0 • updated 11 days ago by michael.ante3.0k
0
votes
0
answers
170
views
0
answers
Comment: C: count file having zero
... I created GTF file from this command: awk -v OFS="\t" '{print $1, "myIntergenic","intergenic", $2, $3, ".", "+", ".", sprintf("gene_id \"%s\"; transcript_id \"%s:%s-%s\"" ";", $4, $1, $2, $3 )}' l.bed > o.gtf so it looks like this: SL3.0ch00 myIntergenic intergenic 1230877 1231088 . + ...
written 11 days ago by BioBaby0
0
votes
0
answers
170
views
0
answers
Comment: C: count file having zero
... here I am giving my gtf file which looks like: SL3.0ch00 pfurio peak 0 16479 . + . peak_id "SL3.0ch00_0_16479"; SL3.0ch00 pfurio peak 17940 328351 . + . peak_id "SL3.0ch00_17940_328351"; SL3.0ch00 pfurio peak ...
written 13 days ago by BioBaby0
0
votes
0
answers
170
views
0
answers
Comment: C: count file having zero
... Thanks Ryan...I removed duplicate. Here I should mention that I am working novel lincRNA so my annotation file does not have that information.Then how to calculate count? any other way to do it. It may look silly but do not have idea. ...
written 14 days ago by BioBaby0
0
votes
0
answers
170
views
0
answers
count file having zero
... I have some non-coding region sequence around 5000 and some tissue specific reads data. I want to do differential gene expression analysis. So I want to check which tissue specific reads having these non coding sequences for that I aligned them (where I created database for those non coding sequence ...
next-gen alignment tool rna-seq written 17 days ago by BioBaby0 • updated 17 days ago by b.nota6.1k

Latest awards to BioBaby

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1848 users visited in the last hour