User: priya120195

gravatar for priya120195
Reputation:
0
Status:
New User
Last seen:
22 hours ago
Joined:
1 month, 3 weeks ago
Email:
p**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by priya120195

<prev • 13 results • page 1 of 2 • next >
0
votes
2
answers
93
views
2
answers
Comment: C: problem in conversion of sam to bam file
... yes I always use nohup ...
written 23 hours ago by priya1201950
0
votes
2
answers
93
views
2
answers
Comment: C: problem in conversion of sam to bam file
... head newoutputERX676467.sam [M::bwa_idx_load_from_disk] read 0 ALT contigs @SQ SN:NC_000001.11 LN:248956422 @SQ SN:NT_187361.1 LN:175055 @SQ SN:NT_187362.1 LN:32032 @SQ SN:NT_187363.1 LN:127682 @SQ SN:NT_187364.1 LN:66860 @SQ SN:NT_187365.1 LN:40176 @SQ SN:NT_187 ...
written 23 hours ago by priya1201950 • updated 23 hours ago by WouterDeCoster36k
2
votes
2
answers
93
views
5 follow
2
answers
problem in conversion of sam to bam file
... hi, I used Bwa tool for mapping to get .sam file in output.Now I used samtools view to convert this .sam file into .bam file but it is not running.It gets exit within a second. Can anyone suugest why this is happening? The command I am using is samtools view -bS newoutputERX676467.sam > ...
software error next-gen alignment written 23 hours ago by priya1201950 • updated 22 hours ago by Pierre Lindenbaum117k
0
votes
2
answers
103
views
2
answers
Comment: C: Difficulty in Host removal by Bowtie2,samtools and bedtools
... my experiment is comparative analysis of human gut microbiome of diseased samples.In this regard my pipeline includes quality filtering ,host genome removal,mapping ,analysis of WGS by megan. In the host removal step we are using bowtie2 which generate sam file ,samtools which convert this sam file ...
written 1 day ago by priya1201950
0
votes
2
answers
103
views
2
answers
Comment: C: Difficulty in Host removal by Bowtie2,samtools and bedtools
... a) bowtie2 mapping against host sequence Host example: human genome hg19 (download bowtie2 hg19 index) 1) create bowtie2 index database (host_DB) from host reference genome bowtie2-build host_genome.fna host_DB 2) bowtie2 mapping against host sequence database, keep both mapped and unmapped r ...
written 1 day ago by priya1201950 • updated 1 day ago by WouterDeCoster36k
2
votes
2
answers
103
views
2
answers
Difficulty in Host removal by Bowtie2,samtools and bedtools
... hi, I am struggling with host removal step during whole genome shotgun sequencing analysis pipeline of paired end data. When I am running my dataset for mapping with bowtie2 ,It is generating SAM file,it is further ran by samtools.I am getting wrong bam file,because I am getting tructated file in ne ...
genome software error next-gen sequencing written 2 days ago by priya1201950 • updated 2 days ago by Antonio R. Franco4.0k
2
votes
0
answers
111
views
0
answers
Problem in paired end data due to annotation
... my raw files look like @ERX123456.1.1 HWI-ST1018:118:D1RUFACXX:6:1101:1217:2216 length=101 NGGTCAAGAGCGCTTCCACCAACGCACAGCTGGTTGCTGAGGACATCGCTCGTCAGCTGGAGAACCGTGTGACCTTCCGCCGTGCTATGAAGCAGTGCATG +ERX123456.1.1 HWI-ST1018:118:D1RUFACXX:6:1101:1217:2216 length=101 #0 ...
next-gen sequence written 26 days ago by priya1201950 • updated 26 days ago by Bastien Hervé3.3k
0
votes
0
answers
239
views
0
answers
Comment: C: TRUNCATED FILE CREATION when samtools is used to produce both_ends_unmapped.bam
... I tried with all my samples, but still I am struggling with same issue. All the commands are running perfectly ,even the bam file generated is having size in Gb but why I am lacking i am not getting. Even other people of my lab are running the same tool and they are not facing this issue . ...
written 4 weeks ago by priya1201950
0
votes
0
answers
239
views
0
answers
Comment: A: TRUNCATED FILE CREATION when samtools is used to produce both_ends_unmapped.bam
... Please help me in resolving my query ...
written 5 weeks ago by priya1201950
0
votes
0
answers
239
views
0
answers
Comment: A: TRUNCATED FILE CREATION when samtools is used to produce both_ends_unmapped.bam
... The ouput of the command $ file sample _mapped and unmapped. bam is sample_mapped and unmapped.bam : data Please tell what this output signify? Is there any issue with bam file? ...
written 6 weeks ago by priya1201950 • updated 5 weeks ago by RamRS20k

Latest awards to priya120195

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1891 users visited in the last hour