User: priya120195

gravatar for priya120195
priya12019510
Reputation:
10
Status:
New User
Location:
Last seen:
6 days, 5 hours ago
Joined:
1 year, 3 months ago
Email:
p**********@gmail.com

Posts by priya120195

<prev • 29 results • page 1 of 3 • next >
0
votes
1
answer
73
views
5 follow
1
answer
FASTA file split
... Hii, I have a merged fasta file of 1500 sequences.I want to split it into only 2 files ,one having 1000 fasta sequnces and other having 500 fasta sequences with headers intact.Can anyone suggest me the way with proper command to do it easily by awk or grep? ...
alignment sequence written 6 days ago by priya12019510 • updated 6 days ago by lakhujanivijay4.8k
0
votes
3
answers
726
views
3
answers
Comment: C: Is it possible to download the full EpiCov database from GISAID?
... Thanks,I also have msged them by contact,but nothing updated till now. Why this is so that this feature is activated for some users and not for all?I am not able to figure out this. ...
written 8 days ago by priya12019510
0
votes
3
answers
726
views
3
answers
Comment: C: Is it possible to download the full EpiCov database from GISAID?
... data/gisaid_cov2020_sequences.fasta I am unable to get this from the site.There is no download option for this ,only acknowledgement table is there. ...
written 8 days ago by priya12019510
4
votes
1
answer
88
views
1
answer
repeatmasker plain text into gtf
... THIS IS MY PLAIN TEXT FILE: cat filtered_for_repeatsgtf.txt |head 239 chr1 67108752 67108881 + RLTR17B_Mm LTR ERVK 314 chr1 3145673 3145796 - RMER16A3 LTR ERVK 3620 chr1 5242237 5242959 - RMER13B LTR ERVK 1530 chr1 7339880 7340133 - MYSERV6-int LTR ERVK 2842 chr1 9436682 ...
next-gen alignment sequencing written 24 days ago by priya12019510 • updated 24 days ago by Dave Carlson320
0
votes
0
answers
89
views
0
answers
Comment: C: issue running DeepMod
... My question is Can we run tools like Deepmod,Deepsignal,Tombo in HPC clusters?? ...
written 9 weeks ago by priya12019510
0
votes
0
answers
89
views
0
answers
issue running DeepMod
... Can we run DeepMod tool on HPC cluster? I am trying to analyse Nanopore data by submitting the deepmod script through "qsub" in cluster,but it got stopped after giving error of minimap2 file not found. the point here is , that this tool is already present in cluster and also I tried by giving the ...
software error assembly next-gen sequencing written 9 weeks ago by priya12019510
0
votes
0
answers
88
views
0
answers
Comment: C: issue with mapped file
... THIS IS VCF FILE : zcat HL_intersection.vcf.gz |grep "90775878" chr1 90775878 . GGGACTGCTGGCTTAGCAGGGACTGGCTTAGCAGCAGCTGGCTGAGGAGGGGCTGGCTGAGCA G 31.95 PASS . GT:AD:AF:DP:F1R2:F2R1:GQ:PL:GP:PRI:SB:MB:PS 0|1:30,12:0.286:42:14,7:16,5:32:66,0,50:31.95,0.002796,53:0,34,37:12,18,5,7:14,16,4,8:90 ...
written 12 weeks ago by priya12019510 • updated 12 weeks ago by Pierre Lindenbaum127k
0
votes
0
answers
88
views
0
answers
Comment: C: issue with mapped file
... i generated my bam files and vcf files by dragen tool to find the variants. Then i annotated my vcgf files.I got 12 bp deletion in the responsible gene in all my vcf files.So i just cross checked my bam files if that region is present in mapped files or not.It should be present in bam files but its ...
written 12 weeks ago by priya12019510
0
votes
0
answers
88
views
0
answers
issue with mapped file
... i really want to know why i am getting a deletion in vcf file but its not present in my bam file when i am visulaising it by igv ...
alignment sequence written 12 weeks ago by priya12019510
0
votes
0
answers
125
views
0
answers
error in IDR (irreproducible discovery rate)
... res <- est.IDR(dat, mu=3, sigma=1, rho=.9, p=.5) Error in while (to.run) { : missing value where TRUE/FALSE needed why I am getting this error ...
R next-gen written 3 months ago by priya12019510 • updated 3 months ago by lieven.sterck7.2k

Latest awards to priya120195

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1060 users visited in the last hour