User: priya120195

gravatar for priya120195
Reputation:
0
Status:
New User
Last seen:
1 month, 2 weeks ago
Joined:
6 months, 4 weeks ago
Email:
p**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by priya120195

<prev • 19 results • page 1 of 2 • next >
0
votes
0
answers
186
views
0
answers
Comment: C: Problem in paired-end data due to annotation
... no I didnt use this ,as it was paired end data ,i direct used fastq -dump split files command to get 2 reads ...
written 3 months ago by priya1201950
0
votes
0
answers
186
views
0
answers
Comment: C: Problem in paired-end data due to annotation
... yes I have used fastq-dump. ...
written 3 months ago by priya1201950
0
votes
0
answers
186
views
0
answers
Comment: C: Problem in paired-end data due to annotation
... 1)they were downloaded from SRA by prefetch command of sratool kit. Yes I have R1 and R2 reads in separate files. 2) Command ./prinseq-lite.pl -verbose -fastq file_R1.fastq -fastq2 file_R2.fastq -max_qual_mean 20 -derep 1 -no_qual_header -log file.log I already have process plenty of fastq f ...
written 3 months ago by priya1201950 • updated 3 months ago by h.mon26k
0
votes
0
answers
186
views
0
answers
Problem in paired-end data due to annotation
... Running of Prinseq tool for filtering of paired end reads gives singletons file,good file and bad file separately. I got the correct results when I worked on files having header like @HWI-ST1025:8:1101:1826:1992 TATGCTGAAGAAGACTCCTGTCAACTCGCTGAATGTTTCATTTGTAGCACGTAACTTGTGCTATCTGATGAAGCAC ...
next-gen alignment sequencing written 3 months ago by priya1201950
0
votes
2
answers
253
views
2
answers
Comment: C: problem in conversion of sam to bam file
... i tried with this also,but still it is not working. ...
written 5 months ago by priya1201950
0
votes
2
answers
253
views
2
answers
Comment: C: problem in conversion of sam to bam file
... I used this command only,which u have mentioned above. ...
written 5 months ago by priya1201950
0
votes
2
answers
253
views
2
answers
Comment: C: problem in conversion of sam to bam file
... yes I always use nohup ...
written 5 months ago by priya1201950
0
votes
2
answers
253
views
2
answers
Comment: C: problem in conversion of sam to bam file
... head newoutputERX676467.sam [M::bwa_idx_load_from_disk] read 0 ALT contigs @SQ SN:NC_000001.11 LN:248956422 @SQ SN:NT_187361.1 LN:175055 @SQ SN:NT_187362.1 LN:32032 @SQ SN:NT_187363.1 LN:127682 @SQ SN:NT_187364.1 LN:66860 @SQ SN:NT_187365.1 LN:40176 @SQ SN:NT_187 ...
written 5 months ago by priya1201950 • updated 5 months ago by WouterDeCoster40k
3
votes
2
answers
253
views
5 follow
2
answers
problem in conversion of sam to bam file
... hi, I used Bwa tool for mapping to get .sam file in output.Now I used samtools view to convert this .sam file into .bam file but it is not running.It gets exit within a second. Can anyone suugest why this is happening? The command I am using is samtools view -bS newoutputERX676467.sam > ...
software error next-gen alignment written 5 months ago by priya1201950 • updated 5 months ago by Pierre Lindenbaum121k
0
votes
2
answers
301
views
2
answers
Comment: C: Difficulty in Host removal by Bowtie2,samtools and bedtools
... my experiment is comparative analysis of human gut microbiome of diseased samples.In this regard my pipeline includes quality filtering ,host genome removal,mapping ,analysis of WGS by megan. In the host removal step we are using bowtie2 which generate sam file ,samtools which convert this sam file ...
written 5 months ago by priya1201950

Latest awards to priya120195

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1656 users visited in the last hour