User: bioz

gravatar for bioz
bioz10
Reputation:
10
Status:
New User
Location:
Last seen:
2 months, 2 weeks ago
Joined:
6 months ago
Email:
d****************@gmail.com

Posts by bioz

<prev • 8 results • page 1 of 1 • next >
2
votes
0
answers
151
views
0
answers
Bowtie out put interpretation
... Hai, I did bowtie using theses commands bowtie --best -v 0 -a -n 0 --un unalig.fa database -f control.fa > out.bowtie I got Result like this 5856 + osa 0 TCGGACCAGGCTTCAATCCCT IIIIIIIIIIIIIIIIIIIII 8 5592 + zma 0 TCGGACCAGGCTTCAATCCCT IIIIIIIIIIIIIIIIIIIII 8 5516 + zma 0 TC ...
alignment next-gen rna-seq bowtie written 3 months ago by bioz10 • updated 3 months ago by Friederike4.8k
4
votes
1
answer
160
views
1
answer
Bam to mapped fasta
... Hai, I have a bam file and i need two fasta file, One is exactly mapped to reference and next one is not mapped to reference How to do with samtools ? ...
rna-seq written 3 months ago by bioz10 • updated 3 months ago by Devon Ryan91k
0
votes
1
answer
133
views
1
answers
Comment: C: Mirna Prediction from mirbase database
... I also tried to change "U" to "T" from reference but i dint get any alignment percentage.Which aligner i can trust ? ...
written 3 months ago by bioz10
3
votes
1
answer
133
views
1
answer
Mirna Prediction from mirbase database
... Hai Stars, I want to identify known and conserved miRNAs from my data. For that i trimmed my reads (fastq Paired end) based on the length: 16bp minimum and maximum of 36 bp. For conserved miRNA identification i downloaded mirbase matured miRNA and i did homology search. But i didn't get any results ...
next-gen rna-seq sequencing written 3 months ago by bioz10 • updated 3 months ago by Buffo1.6k
4
votes
0
answers
177
views
0
answers
Aligning fasta files
... Hello stars, I have two fasta files, one is from Sanger sequencing machine out put and other is reference file. I want to align these fasta files and need out put in SAM/BAM format. Any idea, solution ? ...
gene assembly next-gen sequence written 3 months ago by bioz10
2
votes
2
answers
245
views
2
answers
DEG from BAM file
... Hi, I have an alignment file in bam format from STAR aligner. I want to study Differential expression gens from this bam file, I need all informations like p-value fold-change triplicate values ECT for plotting heat map and volcano. Is it possible to make these plots from alignment bam file ? ...
gene R rna-seq deg written 5 months ago by bioz10 • updated 5 months ago by WouterDeCoster40k
0
votes
1
answer
280
views
1
answer
DEG analysis from gene list
... Hai stars, I did DEG from transcriptome data and i need to plot Heat map and volcano plot from this excel file Gene name log2FoldChange padj description xxxxx -0.41 0.235 xxxxxx xxxx 0.041 0.35 xxxx Which tool will help me to do this ...
rna-seq deg written 5 months ago by bioz10 • updated 5 months ago by Buffo1.6k
0
votes
0
answers
168
views
0
answers
Gene functional annotation from Cuff diff out
... Dear stars, I did cuffdiff analysis and find out i got DEGs (with gene names). I want to know the function of the gene and need to add in last column. Which tool will help to do this task ...
cufflinks rna-seq datanalyisi sequencing written 6 months ago by bioz10

Latest awards to bioz

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1367 users visited in the last hour