User: evelyn

gravatar for evelyn
evelyn130
Reputation:
130
Status:
Trusted
Location:
Last seen:
3 months ago
Joined:
2 years ago
Email:
t*******@gmail.com

Posts by evelyn

<prev • 263 results • page 1 of 27 • next >
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... I have changed the `SM` but I am not sure how to change `ID` which `freebayes` is complaining about. ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... I have checked the fastq file header: @S79.1 1 length=150 CAAAAGATTATTTTAGAAAGCACAATGTGAGGACAGAACTCTACAAAGTGCTGAATGCAAAGAAATACAATTCTGCAGATCCAATTCCATTAAGATTTAAGTGATGCCCCTACTTTTCCAAGGTCCTCAAGTTCCTTTGAGATTTGCTCC +S79.1 1 length=150 A<, ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... Thank you! I got the fastq files from a collaborator. I don't have information about these variables. What can be the best way to find this information? ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... I understand I need to add read groups information. But I could not find where to look for this information. How to check what is RGID, RGLB, RGPL, RGPU for my samples in order to add this information using picard. ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... It shows nothing for read group. ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... Thank you! How can I add the readgroup information to bam files using picard. Where can I find the readgroup information for the data I have. ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
0
answers
Comment: C: freebayes error variant calling
... I checked the readgroups for the two samples it is showing error for using: samtools view -H sample.bam | grep "SM:" It is showing different names for both the files based on their respective sample names. ...
written 6 months ago by evelyn130
0
votes
0
answers
263
views
5 follow
0
answers
freebayes error variant calling
... Hello, I am using `freebayes` for variant calling using: list=list.txt freebayes -f transcripts.fasta -L $list --ploidy 2 \ --min-alternate-fraction 0.2 \ --min-alternate-count 2 \ --min-coverage 3 ...
snp written 6 months ago by evelyn130
0
votes
0
answers
185
views
0
answers
Comment: C: freebayes problem in sample name in vcf
... It shows, `@RG ID:4 LB:lib1 PL:ILLUMINA SM:20 PU:unit1` ...
written 6 months ago by evelyn130
0
votes
0
answers
185
views
0
answers
(Closed) freebayes problem in sample name in vcf
... Hello, I am using following command to create a `vcf` file with `freebayes`: freebayes -f transcripts.fasta duplicates.bam --max-complex-gap 1 \ --theta 0.01 \ --ploidy 2 \ --min-alternate-fraction 0.2 \ ...
snp written 6 months ago by evelyn130

Latest awards to evelyn

Popular Question 3 months ago, created a question with more than 1,000 views. For samtools SNP calling
Popular Question 3 months ago, created a question with more than 1,000 views. For samtools index error
Popular Question 5 months ago, created a question with more than 1,000 views. For basename: missing operand
Popular Question 6 months ago, created a question with more than 1,000 views. For basename: missing operand
Popular Question 6 months ago, created a question with more than 1,000 views. For basename: missing operand
Scholar 7 months ago, created an answer that has been accepted. For C: Fastq to BAM
Popular Question 7 months ago, created a question with more than 1,000 views. For samtools index error
Popular Question 9 months ago, created a question with more than 1,000 views. For samtools index error
Popular Question 9 months ago, created a question with more than 1,000 views. For basename: missing operand
Popular Question 12 months ago, created a question with more than 1,000 views. For basename: missing operand
Supporter 16 months ago, voted at least 25 times.
Centurion 16 months ago, created 100 posts.
Scholar 19 months ago, created an answer that has been accepted. For C: Fastq to BAM

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1906 users visited in the last hour
_