User: juanjo75es

gravatar for juanjo75es
juanjo75es10
Reputation:
10
Status:
New User
Location:
Last seen:
1 day, 5 hours ago
Joined:
6 days, 23 hours ago
Email:
j*********@gmail.com

Posts by juanjo75es

<prev • 2 results • page 1 of 1 • next >
1
vote
1
answer
90
views
1
answers
Comment: C: Problem finding sequence in mouse dna despite blast finds it
... Hi h.mon As I said, I already found that sequence using BLAST. That same screen that you posted. The problem is when I try to download that sequence and the surrounding area. This sequence is not what I get if use these positions as parameters in the ensembl browser. What I get is that: >2 d ...
written 6 days ago by juanjo75es10 • updated 6 days ago by h.mon26k
3
votes
1
answer
90
views
1
answer
Problem finding sequence in mouse dna despite blast finds it
... I downloaded an alignment of 35 mammals. I selected a random fragment. In the case of mouse it corresponded to this section: >mus_musculus_2_9117025_9127689_-1__chr_length=182113224_ TTATTTTGGATAAATACATTAAAAATTTAAATTTAGTTATTGTTAGTACTTGGATAAGTAGGAT When I look for that sequence (just the ...
sequence alignment written 6 days ago by juanjo75es10 • updated 6 days ago by h.mon26k

Latest awards to juanjo75es

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1828 users visited in the last hour