User: juanjo75es

gravatar for juanjo75es
juanjo75es70
Reputation:
70
Status:
Trusted
Location:
Last seen:
3 months, 4 weeks ago
Joined:
9 months, 3 weeks ago
Email:
j*********@gmail.com

Posts by juanjo75es

<prev • 32 results • page 1 of 4 • next >
2
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... Just some updates given that people seem to be quite interested on that topic. (I) I didn't read all comments. Too much nonsesnse IMHO. I will try to focus only on what is interesting for me. Some people here seem to be very young and/or lacking many vital experiences. That's the better explanation ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... Could someone explain me why my answer (the one I consider the right one) was moved to a comment while a deeply wrong answer is keeped? ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... Again you make a deeply unaccurate statement "if we can explain it adequately with 2-3 events". You need a lot more events to explain their alignment. Indeed you need more events than with mine. Unless you believe that DNA replication makes a lot of transcription mistakes in just one event. It's qui ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... Mensur, thanks for replying again. I guessed you realized from the last time that I didn't agree with your reply. I don't think it's the point of this forum to discuss philosophical or political issues. That's why I didn't explain you last time why I think you are deeply wrong. I won't either do thi ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... I am not aligning genes... Biology is not only about genes. The biomedical industry is what seems to be only about genes. People here are biased, And they don't seem to take seriously any scientifical method. Sorry if I generalize. People who do not agree with all bullshit displayed here should say ...
written 6 months ago by juanjo75es70
1
vote
3
answers
1.4k
views
3
answers
Comment: A: Multiple alignment software
... As I take from some comments, looks like the problem here is that my algorithm and the other ones are designed for different goals. Mine is (actually) conceived to align non-conserved sequences while the other two are mostly designed to align conserved regions at which INDELs are less frequent than ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... > Not sure why you write something like this That usually helps to instantly identify those who do not have honest intentions writing an answer. They usually lose their cool for no apparent reason. Apart from that it's (more or less) the truth and it's usually healthy to display the truth . Glad ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... So, finding two almost dentical SINE sequences in two different places of a genome and assuming they are related means "Sorry, but this is a totally wrong assumption". Could you expand on that? ...
written 6 months ago by juanjo75es70
0
votes
3
answers
1.4k
views
3
answers
Comment: C: Multiple alignment software
... These are not random sequences. These are sub-sequences of wider sequences which were found by finding local alignments of a SINE sequence into a genome (if I remember well). Therefore, the sequences in which they are included are likely related. I am not interested on aligning conserved regions. If ...
written 6 months ago by juanjo75es70
53
votes
3
answers
1.4k
views
10 follow
3
answers
Multiple alignment software
... I have these sequences: >a GCATCCCGATGGTCACGGTCGCCACCAGCCTCGCCAACGACGGCA >b GTCCGGCCATGCCCAGCAGCACGGCAAGGGTCAGGCCCACAATCGGA >c GTGCAAACGGATGCCACGCGCGACGCACGCTTCGCCGCGGCGTTTAGC >d GTAGGCCGGGCCGAAGGCGCGACGCTTGTATGCGGAGGCGAACTGCTTGCGA >e GCTGCTCCA ...
alignment tcoffee clustal omega written 6 months ago by juanjo75es70 • updated 6 months ago by Istvan Albert ♦♦ 83k

Latest awards to juanjo75es

Popular Question 4 months ago, created a question with more than 1,000 views. For Multiple alignment software
Scholar 6 months ago, created an answer that has been accepted. For A: Multiple alignment software

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 681 users visited in the last hour