User: juanjo75es

gravatar for juanjo75es
juanjo75es50
Reputation:
50
Status:
Trusted
Location:
Last seen:
3 days, 9 hours ago
Joined:
3 months, 1 week ago
Email:
j*********@gmail.com

Posts by juanjo75es

<prev • 31 results • page 1 of 4 • next >
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... Could someone explain me why my answer (the one I consider the right one) was moved to a comment while a deeply wrong answer is keeped? ...
written 4 days ago by juanjo75es50
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... Again you make a deeply unaccurate statement "if we can explain it adequately with 2-3 events". You need a lot more events to explain their alignment. Indeed you need more events than with mine. Unless you believe that DNA replication makes a lot of transcription mistakes in just one event. It's qui ...
written 4 days ago by juanjo75es50
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... Mensur, thanks for replying again. I guessed you realized from the last time that I didn't agree with your reply. I don't think it's the point of this forum to discuss philosophical or political issues. That's why I didn't explain you last time why I think you are deeply wrong. I won't either do thi ...
written 4 days ago by juanjo75es50
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... I am not aligning genes... Biology is not only about genes. The biomedical industry is what seems to be only about genes. People here are biased, And they don't seem to take seriously any scientifical method. Sorry if I generalize. People who do not agree with all bullshit displayed here should say ...
written 4 days ago by juanjo75es50
1
vote
3
answers
408
views
3
answers
Comment: A: Multiple alignment software
... As I take from some comments, looks like the problem here is that my algorithm and the other ones are designed for different goals. Mine is (actually) conceived to align non-conserved sequences while the other two are mostly designed to align conserved regions at which INDELs are less frequent than ...
written 5 days ago by juanjo75es50
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... > Not sure why you write something like this That usually helps to instantly identify those who do not have honest intentions writing an answer. They usually lose their cool for no apparent reason. Apart from that it's (more or less) the truth and it's usually healthy to display the truth . Glad ...
written 5 days ago by juanjo75es50
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... So, finding two almost dentical SINE sequences in two different places of a genome and assuming they are related means "Sorry, but this is a totally wrong assumption". Could you expand on that? ...
written 5 days ago by juanjo75es50
0
votes
3
answers
408
views
3
answers
Comment: C: Multiple alignment software
... These are not random sequences. These are sub-sequences of wider sequences which were found by finding local alignments of a SINE sequence into a genome (if I remember well). Therefore, the sequences in which they are included are likely related. I am not interested on aligning conserved regions. If ...
written 5 days ago by juanjo75es50
40
votes
3
answers
408
views
10 follow
3
answers
Multiple alignment software
... I have these sequences: >a GCATCCCGATGGTCACGGTCGCCACCAGCCTCGCCAACGACGGCA >b GTCCGGCCATGCCCAGCAGCACGGCAAGGGTCAGGCCCACAATCGGA >c GTGCAAACGGATGCCACGCGCGACGCACGCTTCGCCGCGGCGTTTAGC >d GTAGGCCGGGCCGAAGGCGCGACGCTTGTATGCGGAGGCGAACTGCTTGCGA >e GCTGCTCCA ...
alignment tcoffee clustal omega written 5 days ago by juanjo75es50 • updated 3 days ago by Istvan Albert ♦♦ 81k
1
vote
2
answers
108
views
2
answers
Answer: A: 1000 Human Genomes Project Population Alignment Data
... Here it is all the data (also including low coverage): [http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/data_collections/1000_genomes_project/][1] You can make a script to download only high coverage ones. [1]: http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/data_collections/1000_genomes_project/ ...
written 8 days ago by juanjo75es50

Latest awards to juanjo75es

Scholar 5 days ago, created an answer that has been accepted. For A: Multiple alignment software

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1755 users visited in the last hour