User: hermidalc

gravatar for hermidalc
hermidalc0
Reputation:
0
Status:
New User
Last seen:
2 months, 3 weeks ago
Joined:
5 months, 2 weeks ago
Email:
l******@leandrohermida.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by hermidalc

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
361
views
0
answers
Comment: C: How do I find out the adaptor sequences for SRA data?
... Thank you ATpoint for the recommendations. Submitters to SRA do generally give information regarding library construction protocol like giving the RNA prep kit they used. The SRA toolkit is honestly quite confusing and I also wonder if ENA is removing these adapters. See below in list of options ...
written 12 weeks ago by hermidalc0
0
votes
0
answers
361
views
0
answers
Comment: A: How do I find out the adaptor sequences for SRA data?
... Hi - apologies if I missed the answer somewhere on biostars... so I take it that the `—clip` option in `fasta-dump` isn’t trimming the adapters? Or cannot be completely trusted? ...
written 3 months ago by hermidalc0
0
votes
0
answers
1.6k
views
0
answers
Comment: C: sra-explorer : find SRA and FastQ download URLs in a couple of clicks
... Works great, very useful utility, thank you! ...
written 3 months ago by hermidalc0
0
votes
1
answer
9.1k
views
1
answers
Comment: C: Fast download of FASTQ files from the European Nucleotide Archive (ENA)
... Found the answer, which I suspected when I was writing back, that they modified the FASTQ entry headers: $ pigz -c -d -p 8 SRR8112647_1.fastq.gz | head -20 @SRR8112647.1 1/1 GNGACACAGAGGTCCAGCCCCAGAACTTGTAAGGATTTTGTTTGAACACTGAGCAGATGCCTCCTCCCTGCCAACCATCACACTAGTTAGGGCTGGCCATGAATTCTATGCCA ...
written 3 months ago by hermidalc0 • updated 3 months ago by ATpoint26k
0
votes
1
answer
9.1k
views
1
answers
Comment: C: Fast download of FASTQ files from the European Nucleotide Archive (ENA)
... You counted lines, that's not going to tell you everything. The sizes are very different, and I thought maybe because ENA used higher compression but in my previous post the uncompressed are also very different in size. 4613823652 Sep 6 18:25 SRR8112647_1.fastq.gz 5088093136 Sep 6 18:18 ...
written 3 months ago by hermidalc0
0
votes
1
answer
586
views
1
answers
Comment: C: NCBI SRA AWS AMI
... ATpoint do you have any advice on my post on that thread? https://www.biostars.org/p/325010/#397583 ...
written 3 months ago by hermidalc0
0
votes
1
answer
9.1k
views
1
answers
Comment: A: Fast download of FASTQ files from the European Nucleotide Archive (ENA)
... Has anyone noticed why, for the same run, FASTQ files downloaded from ENA are not the same size as those produced from SRA? Is there an obvious reason why that I might've missed? My SRA procedure: prefetch SRR8112647 vdb-validate SRR8112647.sra parallel-fastq-dump --threads 12 --sra-i ...
written 3 months ago by hermidalc0
0
votes
1
answer
586
views
1
answers
Comment: A: NCBI SRA AWS AMI
... Maybe I'm doing something wrong but I've configured the AWS CLI on my local computer with appropriate `us-east-1` region and tried to download an SRA file: aws s3 cp s3://sra-pub-run-3/SRR292241/SRR292241.3 SRR292241.sra It says it's forbidden (403). From this thread it seems to me that easy ...
written 3 months ago by hermidalc0

Latest awards to hermidalc

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 727 users visited in the last hour