User: harry

gravatar for harry
New User
Last seen:
5 months, 3 weeks ago
8 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by harry

<prev • 17 results • page 1 of 2 • next >
cut the sequence from fasta file
... gggggaattggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctgcggacataaagc Ex- I have like this whole fasta sequence . i want to extract particular sequence like if i want 5 to 20 sequence only from my fasta sequence. then how i extract those sequence. thanks ...
sequence written 7 months ago by harry0 • updated 7 months ago by finswimmer13k
7 follow
know the grep command for fastq file
... I have junction read sequence like this -HISEQ:151:HHKH7BCXX:2:1203:18952:80029 and i want to grep this sequence from my fastq file . so please tell me how i grep this sequence. ...
rna-seq written 7 months ago by harry0 • updated 7 months ago by gsk118520
Comment: C: sed or awk command
... it will remove other (.) from other column. ...
written 7 months ago by harry0
5 follow
sed or awk command
... ENST00000448914.1 13 4.28456 0 0 ENST00000415118.1 8 3.52171 0 0 how to remove the (.*) from column 1 and it looks like ENST00000448914 13 4.28456 0 0 ENST00000415118 8 3.52171 0 0 please tell me the sed command or awk command to remove it only . ...
rna-seq written 7 months ago by harry0 • updated 7 months ago by SMK1.9k
Comment: A: Error IsoformSwitchAnalyzeR with kallisto data and ensembl annotation gtf
... I also have same problem and i have latest version then why is it show this error ...
written 7 months ago by harry0
IsoformswitchanalyzeR analysis error
... aSwitchList <- importRdata( isoformCountMatrix = kallistoQuant$counts, isoformRepExpression = kallistoQuant$abundance, designMatrix = myDesign, isoformExonAnnoation = "/home/lab/project/kallisto_index/hivhuman.gtf", isoformNtFasta = "/home/lab/transcriptome/humantranscript ...
rna-seq written 7 months ago by harry0
Comment: C: import of kallisto file into R through IsoformswitchanalyzeR
... The following commands are i used but i didn't import my file in R please suggest me how i import it. > kallistoQuant <- importIsoformExpression( <-"/home/lab/RNA/kallisto/1/1_AGTCAA_L002_R1_005/" ,(package = " IsoformSwitchAnalyzeR ")) ...
written 7 months ago by harry0
Comment: C: import of kallisto file into R through IsoformswitchanalyzeR
... kallistoabundance <- importIsoformExpression(home/aclab/CircRNA/project/kallisto/1/1_AGTCAA_L001_R1_001.out/abundance.tsv ,(package="IsoformSwitchAnalyzeR")) this is correct or not plz tell me becoz it shows error . ...
written 7 months ago by harry0
import of kallisto file into R through IsoformswitchanalyzeR
... Can anyone tell me the command for importing my kallisto file in R. I am new in this type of work so please suggest me. I use IsoformswitchanalyzeR to import it so please suggest through this command line . ...
rna-seq written 7 months ago by harry0 • updated 7 months ago by ATpoint30k
Isoform switch analyzer installation
... I install the bioconductor packages for installing the IsoformSwitchAnalyzeR in R but it didn't install. it shows error like - ------------------------- ANTICONF ERROR --------------------------- Configuration failed because libcurl was not found. Try installing: * deb: libcurl4-openssl-dev (Debian ...
rna-seq written 7 months ago by harry0

Latest awards to harry

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1591 users visited in the last hour