User: harry

gravatar for harry
harry10
Reputation:
10
Status:
New User
Location:
Last seen:
45 minutes ago
Joined:
1 year, 8 months ago
Email:
a**********@gmail.com

Posts by harry

<prev • 56 results • page 1 of 6 • next >
0
votes
2
answers
89
views
2
answers
Comment: C: Want to reverse the fasta sequence
... I don't want reverse complementary sequence, I just want to only reverse the sequence. ...
written 8 hours ago by harry10
3
votes
2
answers
89
views
7 follow
2
answers
Want to reverse the fasta sequence
... >ENST00000014935 TAGGTTTTTAATTACCTTTATTTTATTTTGCCAAACATACCTGGGAATACCTTTTATTTTTTTTTTACCTTGGGGTGATGGTTCCAAACCATAAATGTGATTATAGTTAACACATGACCCTTCTAGCGTCCCAGCCAGTGTTTTTCCTGACCTCTCTTCTTTGGAGAGGAGGATGGAAGGGAGGGGTCCGGCATGCTGCTGGCATTTTGCTGTGTCCTGCAGCCCCTTTCCGGGACACCTGGGTTCACACAGCTTTTTAGCTTACATAAC ...
fasta written 12 hours ago by harry10 • updated 4 hours ago by predeus1.5k
2
votes
2
answers
68
views
2
answers
want to extract all column which have particular value
... I want to separate the column on the basis of $7=-1 or $7=1 value. So is there awk command to doing this? 10 100009838 100009947 ENST00000324109 ENSE00001424407 1 -1 10 100042193 100042573 ENST00000370418 ENSE00001887192 9 -1 10 ...
extract awk written 3 days ago by harry10 • updated 3 days ago by ashishjayamohan0
5
votes
2
answers
128
views
2
answers
Extract column which contain <20 exons in a transcript
... The first 3 column contains the genome coordinates 4th column contains transcript name 5th column contains exon name and 6th column contain exon rank. So I want to separate this file into 2 files: 1st files if the transcript contains a total <20 exons then print all exons and another file in whic ...
extract exons transcript written 8 days ago by harry10 • updated 8 days ago by Pierre Lindenbaum134k
1
vote
1
answer
119
views
6 follow
1
answer
change the header of fasta sequence
... >exon9_ENST00000462434|exon11_ENST00000462434|exon12_ENST00000462434|exon13_ENST00000462434|exon19_ENST00000462434|exon22_ENST00000462434|exon25_ENST00000462434| GCAAATGAAACACCTGTTGGTCTTCTAATCCATTTGGGGGGTTTTTTCAGGGGAGGTATCAGTGGTGCTTGTGCCACTTGCTCTGGCACCTGCAGTGGTGGGAGAGGCTGGCCTTTGCTGAAGGAAG ...
fasta name written 13 days ago by harry10 • updated 12 days ago by manvikakkar5650
0
votes
0
answers
69
views
0
answers
Comment: C: circBase related query
... can please anyone tells me. Thanks in advance ...
written 16 days ago by harry10
0
votes
1
answer
112
views
1
answers
Comment: C: for loop command
... Please can anyone suggest to me how to do it. I am waiting for answers. Thanks in advance. ...
written 16 days ago by harry10
0
votes
1
answer
112
views
1
answers
Comment: C: for loop command
... yes, I want to add code before this javascript. >ENST00000014935::X:154402942-154403190 TCCTCCTCGGTGAGCTGGAAGCTCGTGGGGAAGTCAAAGGCAGCCGCAGTGTGCAGCAGACTCCGGCAGCGCTCCCCGTGCAGCACGACGCGGTCATAGGTGCAGTGGGTGCTGGCCCGCACTGTGGTGTCCTCCCCATCGGCAATCACCCAGTGGAAGCCTGGCTCAGTCCGCAGCTCCAGCTTGTCCAGG ...
written 18 days ago by harry10
0
votes
1
answer
112
views
1
answers
Comment: C: for loop command
... No, I want to select all the transcripts one by one in a loop present in my file. This is the whole command for which i want to write for loop command:- So as I have different types of sequences in my fasta file. So which have same transcript id I want to select it and put it in the below commad li ...
written 20 days ago by harry10
0
votes
1
answer
112
views
1
answer
for loop command
... I have fasta sequence and I want to write a script for "for loop" command:- >ENST00000014935::X:154401758-154402841 TAGGTTTTTAATTACCTTTATTTTATTTTGCCAAACATACCTGGGAATACCTTTTATTTTTTTTTTACCTTGGGGTGATGGTTCCAAACCATAAATGTGATTATAGTTAACACATGACCCTTCTAGCGTCCCAGCCAGTGTTTTTCCTGACCTCTCTTCTTTGGAGAGGAGG ...
fasta for loop written 20 days ago by harry10 • updated 20 days ago by lieven.sterck10k

Latest awards to harry

Popular Question 21 days ago, created a question with more than 1,000 views. For convert genome file to transcriptome file
Popular Question 26 days ago, created a question with more than 1,000 views. For convert genome file to transcriptome file
Popular Question 8 months ago, created a question with more than 1,000 views. For convert genome file to transcriptome file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1271 users visited in the last hour
_