User: m986

gravatar for m986
m9860
Reputation:
0
Status:
New User
Last seen:
3 days, 16 hours ago
Joined:
2 weeks, 3 days ago
Email:
m******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by m986

<prev • 5 results • page 1 of 1 • next >
0
votes
1
answer
109
views
1
answer
a CDS without gene_Id's can be annotated?
... What is the correct way to make an annotation in a **CDS** file without ID gene names? This **CDS** is from Capsicum annuum and looks like this: >Id16 ATGCATCATCCCATCTTTCATGCTTCTGGTTCTGTGGAAGGGCATTGGATTAGGATTCCCCCACCTCATAAAACATCATTTTATGCTTCTGACATA TATGATATGAAAGAAGATGAGTCTTTATTCGCCTCA ...
genome cds rna-seq written 16 days ago by m9860 • updated 8 days ago by joe5550
0
votes
2
answers
168
views
2
answers
Comment: C: CDS file (as reference) can be used for align my fastq files?
... My advisor told me that this CDS file (which is actually from another variety of chile, but he says it is almost the same as the one published), has "well identified and annotated genes", but for example, Id_genes only has names like "Id1", "Id2",... etc., so I made a Blastx to give them a "name", b ...
written 16 days ago by m9860
0
votes
2
answers
168
views
2
answers
Comment: C: CDS file (as reference) can be used for align my fastq files?
... Thanks [genomax][1] !!! That answers my main question, I only have one more, if I downoladed the transcriptome and the genome (from [NCBI][2] ) , do you recommend using some of these NCBI files or even using this CDS provided (unpublished)? This is because my final result must be DEG between two phe ...
written 16 days ago by m9860
0
votes
2
answers
168
views
2
answers
Comment: C: CDS file (as reference) can be used for align my fastq files?
... Thank you! Actually I have fastq files which is what I want to align, the fasta file that my advisor gave me is the CDS (CoDing Sequence), it is the "reference" that he suggests using for alignment, I agree with you about using a reference genome, but my advisor insists on using that CDS file to al ...
written 16 days ago by m9860
4
votes
2
answers
168
views
2
answers
CDS file (as reference) can be used for align my fastq files?
... I'm new in rna-seq , so first, I'm sorry if this question is too dumb or if I confuse the definitions. My advisor gave me a fasta file (non-model organism) and told me that I had to use it to map (suggesting using [Bowtie2][1]), the "readme" file of this says [This file contains the organism "genes" ...
cds alignment rna-seq written 17 days ago by m9860 • updated 16 days ago by swbarnes26.2k

Latest awards to m986

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1670 users visited in the last hour