User: m986

gravatar for m986
m9860
Reputation:
0
Status:
New User
Last seen:
2 months, 3 weeks ago
Joined:
11 months ago
Email:
m******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by m986

<prev • 8 results • page 1 of 1 • next >
0
votes
1
answer
252
views
1
answer
enrichgo clusterProfiler: no results, that's possible?
... Hi! I am doing an enrichment analysis using clusterProfiler, with the function: "enrichGO", but in one of my analyzes this does not inform anything enriched, is that possible? *[1] ID Description GeneRatio BgRatio pvalue p.adjust qvalue [8] geneID Count <0 ...
enrichgo go clusterprofiler enrichment analysis written 7 months ago by m9860 • updated 7 months ago by jared.andrews076.1k
0
votes
1
answer
249
views
1
answers
Comment: C: How to contrast gene expression level using like control some HouseKeeping Genes
... awesome! Thank you Asaf!! I'll try . ...
written 9 months ago by m9860
0
votes
1
answer
249
views
1
answer
How to contrast gene expression level using like control some HouseKeeping Genes after a DEG using DESEQ2
... In my lab we have a question about this (we are not experts in bioinformatics by the way, we still learning): We are doing rna-seq of resistant vs susceptible peppers. I did a DEG analysis using DESEQ2, I got up and down regulated genes using a FDR:0.01 and LFC:0.5. Now I have my respective list of ...
rna-seq deseq-2 dge written 9 months ago by m9860 • updated 9 months ago by Asaf8.0k
0
votes
1
answer
233
views
1
answer
a CDS without gene_Id's can be annotated?
... What is the correct way to make an annotation in a **CDS** file without ID gene names? This **CDS** is from Capsicum annuum and looks like this: >Id16 ATGCATCATCCCATCTTTCATGCTTCTGGTTCTGTGGAAGGGCATTGGATTAGGATTCCCCCACCTCATAAAACATCATTTTATGCTTCTGACATA TATGATATGAAAGAAGATGAGTCTTTATTCGCCTCA ...
genome cds rna-seq written 11 months ago by m9860 • updated 10 months ago by joe5550
0
votes
2
answers
371
views
2
answers
Comment: C: CDS file (as reference) can be used for align my fastq files?
... My advisor told me that this CDS file (which is actually from another variety of chile, but he says it is almost the same as the one published), has "well identified and annotated genes", but for example, Id_genes only has names like "Id1", "Id2",... etc., so I made a Blastx to give them a "name", b ...
written 11 months ago by m9860
0
votes
2
answers
371
views
2
answers
Comment: C: CDS file (as reference) can be used for align my fastq files?
... Thanks [genomax][1] !!! That answers my main question, I only have one more, if I downoladed the transcriptome and the genome (from [NCBI][2] ) , do you recommend using some of these NCBI files or even using this CDS provided (unpublished)? This is because my final result must be DEG between two phe ...
written 11 months ago by m9860
0
votes
2
answers
371
views
2
answers
Comment: C: CDS file (as reference) can be used for align my fastq files?
... Thank you! Actually I have fastq files which is what I want to align, the fasta file that my advisor gave me is the CDS (CoDing Sequence), it is the "reference" that he suggests using for alignment, I agree with you about using a reference genome, but my advisor insists on using that CDS file to al ...
written 11 months ago by m9860
4
votes
2
answers
371
views
2
answers
CDS file (as reference) can be used for align my fastq files?
... I'm new in rna-seq , so first, I'm sorry if this question is too dumb or if I confuse the definitions. My advisor gave me a fasta file (non-model organism) and told me that I had to use it to map (suggesting using [Bowtie2][1]), the "readme" file of this says [This file contains the organism "genes" ...
cds alignment rna-seq written 11 months ago by m9860 • updated 11 months ago by swbarnes27.9k

Latest awards to m986

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 787 users visited in the last hour