User: eli_bayat

gravatar for eli_bayat
eli_bayat20
Reputation:
20
Status:
New User
Location:
Last seen:
1 month ago
Joined:
7 months, 1 week ago
Email:
e********@yahoo.com

Posts by eli_bayat

<prev • 10 results • page 1 of 1 • next >
1
vote
1
answer
75
views
1
answer
How to find genes and function of particular species such as Lactobacillus Crispatus?
... How to find genes and functions of a species, for example I have Lactobacillus Crispatus species and am interested in its genes and functions related to it. I tried KEEG and it was very confusing. ...
pathway keeg bacteria functions gene written 7 weeks ago by eli_bayat20 • updated 7 weeks ago by genomax80k
0
votes
1
answer
144
views
1
answers
Comment: C: How to find a pathway from genes to disease
... Thanks Ashish! my species are bacteria ...
written 8 weeks ago by eli_bayat20
3
votes
1
answer
144
views
5 follow
1
answer
How to find a pathway from bacteria to disease
... Hi, I want to find a pathway from bacteria to genes all the way to a disease. Is there any user friendly website that I can use? I looked into KEEG and it was confusing to me. Any other suggestion would be appreciated. ...
gene pathways bacteria disease keeg written 8 weeks ago by eli_bayat20 • updated 7 weeks ago by Fatima510
2
votes
0
answers
161
views
0
answers
How to get Positive Control gut or Vaginal microbiome dataset
... Hi, I am working on a new filtering method to remove spurious taxa, and I want to validate my method by applying it on Mock community data. I am looking for a dataset for which I know how many true signal (True Taxa) I have versus noise (contaminant,...). Any help to get this dataset would be appr ...
positive control decontamination filtering written 10 weeks ago by eli_bayat20 • updated 6 days ago by Biostar ♦♦ 20
0
votes
1
answer
490
views
1
answers
Comment: C: How to Demultiplex a fastq.gz file.
... Thanks! I appreciate it :) ...
written 7 months ago by eli_bayat20
0
votes
1
answer
490
views
1
answers
Comment: C: How to Demultiplex a fastq.gz file.
... I looked for what each line means, and I get it, the only part I am not getting is NGCCTCTT|1|NCTGCATA|1 at the end of first line. can you help me with this? what it means? ...
written 7 months ago by eli_bayat20
0
votes
1
answer
490
views
1
answers
Comment: C: How to Demultiplex a fastq.gz file.
... Sorry about that, I am pretty new to this forum. @M01380:62:000000000-B547W:1:1102:20819:1013 1:N:0:MWI006 NGCCTCTT|1|NCTGCATA|1 NGTAGAGTTTGATTCTGGCTCAGGATGAACGCTGACAGAATGCTTAACACATGCAAGTCTACTTGATCCTTCGGGTGATGGTGGCGGACGGGTGAGTAACGCGTAAAGAACTTGCCCTGCAGTCTGGGACAACATTTGGAAACGAATGCTAATACCGGATA ...
written 7 months ago by eli_bayat20 • updated 7 months ago by genomax80k
0
votes
1
answer
490
views
1
answers
Comment: C: How to Demultiplex a fastq.gz file.
... This is how the data looks like when I open a fastq file in terminal. There is also a Barcode text file with a column of sample ID and Barcode pair name. ![enter image description here][1] MWI006 is the sample ID and I have a bunch of that with different numbers in one fastq file, which means I ne ...
written 7 months ago by eli_bayat20 • updated 7 months ago by ATpoint31k
0
votes
1
answer
490
views
1
answers
Comment: A: How to Demultiplex a fastq.gz file.
... This is how the data looks like when I open a fastq file in terminal. There is also a Barcode text file with a column of sample ID and Barcode pair name. ![enter image description here][1] [1]: https://i.ibb.co/HF8PH8T/Screenshot-2019-08-23-12-06-40.png ...
written 7 months ago by eli_bayat20 • updated 7 months ago by ATpoint31k
6
votes
1
answer
490
views
1
answer
How to Demultiplex a fastq.gz file.
... I am a new postdoc student and I was given **a folder of fastq.gz files**. I was told they are **not de-multiplexed** and I need to basically **extract each sample information separately from each of these fastq file (they contain info for multiple subjects) and save it as fastq file and run dada2 p ...
illumina fastq de-multiplexing miseq dada2 written 7 months ago by eli_bayat20

Latest awards to eli_bayat

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 831 users visited in the last hour