User: suzuBell

gravatar for suzuBell
suzuBell60
Reputation:
60
Status:
New User
Location:
Last seen:
1 month, 2 weeks ago
Joined:
8 months, 3 weeks ago
Email:
l****************@gmail.com

Posts by suzuBell

<prev • 16 results • page 1 of 2 • next >
2
votes
1
answer
135
views
1
answers
Answer: A: creating interactive plots with bigPint in a DESeq2 analysis
... Hello [Assa Yeroslaviz][1]. Thank you for this suggestion. We added reproducible example analyses and more detailed explanations of columns using `DESeq2`. You can see more information [here][2]. [1]: https://www.biostars.org/u/2295/ [2]: https://github.com/lindsayrutter/bigPint/issues/5 ...
written 7 weeks ago by suzuBell60
0
votes
2
answers
226
views
2
answers
Find overlapping sequences between pairs of protein fasta files
... I have three protein .fasta files (file1.fasta, file2.fasta, and file3.fasta), each in the following format: >MOLCJCMO_00002 [gene=cysS] [locus_tag=HCW_RS04050] [protein=cysteine--tRNA ligase] [protein_id=WP_014660951.1][location=complement(860733..862130)] [gbkey=CDS] MKIFDTHLKQKVPFEPLI ...
fasta overlap protein written 5 months ago by suzuBell60 • updated 5 months ago by Mensur Dlakic5.5k
0
votes
1
answer
851
views
1
answer
Create phylogenetic tree visualization from handful of 16SrRNA .fastq sequences
... I have the 16S rRNA sequence of a new strain of bacteria. I would like to make a simple phylogenetic tree visualization comparing this new strain of bacteria with about 12 other strains of known bacteria. Currently, I have 13 .fastq files (one being the new strain of bacteria), each containing a 16S ...
phylogenetic bacteria 16srrna written 6 months ago by suzuBell60 • updated 6 months ago by Mensur Dlakic5.5k
2
votes
0
answers
269
views
0
answers
Determine all "mobile DNAs" in an assembled bacteria genome (using something like Prokka)
... I have been finding the Prokka software to be very useful annotating an assembled bacterial genome (contigs). I am trying to determine whether this assembled genome contains any "mobile DNAs" (and if so, how many, and their names). Is this something that can be interpreted easily from the Prokka out ...
bacteria mobiledna prokka written 7 months ago by suzuBell60 • updated 6 months ago by Biostar ♦♦ 20
9
votes
3
answers
431
views
8 follow
3
answers
Determine number and length of plasmids in bacterial genome (using something like Prokka)
... I have been finding the [Prokka software][1] to be very useful annotating an assembled bacterial genome (contigs). I wanted to know if anyone has recommendations on how to determine if the assembled bacterial genome (contigs) contains a plasmid. If so, how many plasmids and length of plasmids. I tr ...
plasmid bacteria prokka written 7 months ago by suzuBell60 • updated 7 months ago by hafiz.talhamalik230
0
votes
0
answers
203
views
0
answers
Comment: C: Determine % coding of a bacterial genome sequence
... Thanks @gb. This is an example of what the beginning of the output of getORF looks like for me: >NODE_43_length_251_cov_0.839080_1 [2 - 40] tgcttgattgatagcataatagcggttattataagtggc >NODE_43_length_251_cov_0.839080_2 [36 - 65] gtggctagggggtcttgcaaattcaccgca >NODE_43_len ...
written 7 months ago by suzuBell60
0
votes
0
answers
203
views
0
answers
Comment: C: Determine % coding of a bacterial genome sequence
... Thanks @gb. I also tried the recommendation. My ordered contigs.fasta file has 1,500,360 bases. To determine ORFs, I first tried to use NCBI ORFFinder but it has a 50K limitation. Instead, I then tried getORF from EMBOSS. I used it on Galaxy platform with all the defaults. When I downloaded the resu ...
written 7 months ago by suzuBell60
0
votes
0
answers
203
views
0
answers
Comment: C: Determine % coding of a bacterial genome sequence
... Thanks @gb. I'm in the process of trying your advice now. To make sure I clearly understand these points, I am trying to figure out three values for this bacterial genome 1) % coding, 2) Number of genes, 3) Number of protein coding genes. It sounds like %coding is just taking the total number of bas ...
written 7 months ago by suzuBell60
0
votes
1
answer
222
views
1
answers
Comment: C: Installing and running RNAmmer on Mac ("Unknown platform")
... Hi @yztxwd. Thanks for the comment. I tried changing the second line to both homp (my $uname = "Linux") and homp (my $uname = "IRIX64"). When I used "Linux", and ran the code `rnammer -S bac -m tsu,ssu,lsu -gff output_gff -h output_hmmreport -f output_fasta sample1.fasta` I do now get a output_gff f ...
written 7 months ago by suzuBell60
0
votes
1
answer
222
views
1
answer
Installing and running RNAmmer on Mac ("Unknown platform")
... I recently tried to user rnammer. 1. I first used the web browser version and uploaded a .fasta file. Unfortunately, this resulted in an error as my .fasta file contains more than 1,000,000 total residues (twice as much in fact). 2. I decided to try the command line version to see if it could acce ...
rnammer software error error written 7 months ago by suzuBell60 • updated 7 months ago by yztxwd380

Latest awards to suzuBell


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1700 users visited in the last hour