User: suzuBell

gravatar for suzuBell
suzuBell40
Reputation:
40
Status:
New User
Location:
Last seen:
14 hours ago
Joined:
3 months ago
Email:
l****************@gmail.com

Posts by suzuBell

<prev • 15 results • page 1 of 2 • next >
0
votes
2
answers
41
views
2
answers
Find overlapping sequences between pairs of protein fasta files
... I have three protein .fasta files (file1.fasta, file2.fasta, and file3.fasta), each in the following format: >MOLCJCMO_00002 [gene=cysS] [locus_tag=HCW_RS04050] [protein=cysteine--tRNA ligase] [protein_id=WP_014660951.1][location=complement(860733..862130)] [gbkey=CDS] MKIFDTHLKQKVPFEPLI ...
fasta overlap protein written 14 hours ago by suzuBell40 • updated 10 hours ago by Mensur Dlakic2.4k
0
votes
1
answer
136
views
1
answer
Create phylogenetic tree visualization from handful of 16SrRNA .fastq sequences
... I have the 16S rRNA sequence of a new strain of bacteria. I would like to make a simple phylogenetic tree visualization comparing this new strain of bacteria with about 12 other strains of known bacteria. Currently, I have 13 .fastq files (one being the new strain of bacteria), each containing a 16S ...
phylogenetic bacteria 16srrna written 29 days ago by suzuBell40 • updated 29 days ago by Mensur Dlakic2.4k
2
votes
0
answers
137
views
0
answers
Determine all "mobile DNAs" in an assembled bacteria genome (using something like Prokka)
... I have been finding the Prokka software to be very useful annotating an assembled bacterial genome (contigs). I am trying to determine whether this assembled genome contains any "mobile DNAs" (and if so, how many, and their names). Is this something that can be interpreted easily from the Prokka out ...
bacteria mobiledna prokka written 5 weeks ago by suzuBell40 • updated 4 weeks ago by Biostar ♦♦ 20
9
votes
3
answers
208
views
8 follow
3
answers
Determine number and length of plasmids in bacterial genome (using something like Prokka)
... I have been finding the [Prokka software][1] to be very useful annotating an assembled bacterial genome (contigs). I wanted to know if anyone has recommendations on how to determine if the assembled bacterial genome (contigs) contains a plasmid. If so, how many plasmids and length of plasmids. I tr ...
plasmid bacteria prokka written 5 weeks ago by suzuBell40 • updated 5 weeks ago by hafiz.talhamalik220
0
votes
0
answers
121
views
0
answers
Comment: C: Determine % coding of a bacterial genome sequence
... Thanks @gb. This is an example of what the beginning of the output of getORF looks like for me: >NODE_43_length_251_cov_0.839080_1 [2 - 40] tgcttgattgatagcataatagcggttattataagtggc >NODE_43_length_251_cov_0.839080_2 [36 - 65] gtggctagggggtcttgcaaattcaccgca >NODE_43_len ...
written 6 weeks ago by suzuBell40
0
votes
0
answers
121
views
0
answers
Comment: C: Determine % coding of a bacterial genome sequence
... Thanks @gb. I also tried the recommendation. My ordered contigs.fasta file has 1,500,360 bases. To determine ORFs, I first tried to use NCBI ORFFinder but it has a 50K limitation. Instead, I then tried getORF from EMBOSS. I used it on Galaxy platform with all the defaults. When I downloaded the resu ...
written 6 weeks ago by suzuBell40
0
votes
0
answers
121
views
0
answers
Comment: C: Determine % coding of a bacterial genome sequence
... Thanks @gb. I'm in the process of trying your advice now. To make sure I clearly understand these points, I am trying to figure out three values for this bacterial genome 1) % coding, 2) Number of genes, 3) Number of protein coding genes. It sounds like %coding is just taking the total number of bas ...
written 6 weeks ago by suzuBell40
0
votes
1
answer
105
views
1
answers
Comment: C: Installing and running RNAmmer on Mac ("Unknown platform")
... Hi @yztxwd. Thanks for the comment. I tried changing the second line to both homp (my $uname = "Linux") and homp (my $uname = "IRIX64"). When I used "Linux", and ran the code `rnammer -S bac -m tsu,ssu,lsu -gff output_gff -h output_hmmreport -f output_fasta sample1.fasta` I do now get a output_gff f ...
written 6 weeks ago by suzuBell40
0
votes
1
answer
105
views
1
answer
Installing and running RNAmmer on Mac ("Unknown platform")
... I recently tried to user rnammer. 1. I first used the web browser version and uploaded a .fasta file. Unfortunately, this resulted in an error as my .fasta file contains more than 1,000,000 total residues (twice as much in fact). 2. I decided to try the command line version to see if it could acce ...
rnammer software error error written 6 weeks ago by suzuBell40 • updated 6 weeks ago by yztxwd240
2
votes
0
answers
121
views
0
answers
Determine % coding of a bacterial genome sequence
... Reading a paper with interesting statistics on bacterial genomes ([here][1]). It states that "The average protein coding content of a bacterial genome is 88% for the 2671 finished genomes in GenBank". I have assembled the contigs of a bacterial genome and have a contigs.fasta file. Is there a quic ...
assembly coding protein written 7 weeks ago by suzuBell40

Latest awards to suzuBell


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1743 users visited in the last hour