User: ann-katrin.llarena

Reputation:
0
Status:
New User
Last seen:
8 months, 1 week ago
Joined:
8 months, 3 weeks ago
Email:
a*****************@nmbu.no

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ann-katrin.llarena

<prev • 6 results • page 1 of 1 • next >
0
votes
1
answer
270
views
1
answers
Comment: A: Different alleles or paralogs?
... Thank you ! I came to the conclusion that the variation is due to homologous recombination between different strains and that of course they are two different genes occupying the same space but with different function. Thanks! :) ...
written 8 months ago by ann-katrin.llarena0
1
vote
1
answer
270
views
1
answer
Different alleles or paralogs?
... Hei! This is a bit of a newbie question, but here goes anyway. I did a tblastn search for seven genes (one against one) for a range of bacillus genomes (all refseq for bacillus sens latu). I found that five of the genes are conserved, but two of the genes come in two different variants that kind o ...
gene assembly blast genomics written 8 months ago by ann-katrin.llarena0
0
votes
1
answer
3.2k
views
1
answers
Comment: A: Bedtools getfasta outputting a blank file
... Hi , I can see that this post is older than wood, but I have the exact same issue, even down to mac making excel. Did you figure out some solution for this=? ...
written 8 months ago by ann-katrin.llarena0
0
votes
0
answers
294
views
0
answers
Comment: C: bedtool getfasta only reads the first line of my bedfile
... Thank you for helping, but still it just gives out the hit for the first row in the bed file and ignores the remainder of the file. Eh...any other takes on the issue? ...
written 8 months ago by ann-katrin.llarena0
0
votes
0
answers
294
views
0
answers
Comment: C: bedtool getfasta only reads the first line of my bedfile
... Thank you, I already did. It belongs to the story that I made in on mac - excel and in the file it says "converted from mac format" ...
written 8 months ago by ann-katrin.llarena0
0
votes
0
answers
294
views
0
answers
bedtool getfasta only reads the first line of my bedfile
... Hi all, hope you can help. I have a multifasta file containing genomes of 730something procaryotic genomes (5-6Mb); all contigs/chromosomes are named in headers (as so) >CP009335.1 Bacillus thuringiensis strain HD1011, complete genome TCCTGATGGAACTTTAATTGATGAAAAGAGTCGTGTAAACTTTTTCCATCT ...
gene sequence written 8 months ago by ann-katrin.llarena0 • updated 8 months ago by h.mon29k

Latest awards to ann-katrin.llarena

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1627 users visited in the last hour