User: ann-katrin.llarena

Reputation:
0
Status:
New User
Last seen:
4 days, 3 hours ago
Joined:
1 week, 3 days ago
Email:
a*****************@nmbu.no

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ann-katrin.llarena

<prev • 4 results • page 1 of 1 • next >
0
votes
1
answer
2.9k
views
1
answers
Comment: A: Bedtools getfasta outputting a blank file
... Hi , I can see that this post is older than wood, but I have the exact same issue, even down to mac making excel. Did you figure out some solution for this=? ...
written 10 days ago by ann-katrin.llarena0
0
votes
0
answers
95
views
0
answers
Comment: C: bedtool getfasta only reads the first line of my bedfile
... Thank you for helping, but still it just gives out the hit for the first row in the bed file and ignores the remainder of the file. Eh...any other takes on the issue? ...
written 10 days ago by ann-katrin.llarena0
0
votes
0
answers
95
views
0
answers
Comment: C: bedtool getfasta only reads the first line of my bedfile
... Thank you, I already did. It belongs to the story that I made in on mac - excel and in the file it says "converted from mac format" ...
written 10 days ago by ann-katrin.llarena0
0
votes
0
answers
95
views
0
answers
bedtool getfasta only reads the first line of my bedfile
... Hi all, hope you can help. I have a multifasta file containing genomes of 730something procaryotic genomes (5-6Mb); all contigs/chromosomes are named in headers (as so) >CP009335.1 Bacillus thuringiensis strain HD1011, complete genome TCCTGATGGAACTTTAATTGATGAAAAGAGTCGTGTAAACTTTTTCCATCT ...
gene sequence written 10 days ago by ann-katrin.llarena0 • updated 10 days ago by h.mon27k

Latest awards to ann-katrin.llarena

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 900 users visited in the last hour