User: yztxwd

gravatar for yztxwd
yztxwd380
Reputation:
380
Status:
Trusted
Location:
Southern Medical University
Website:
https://yztxwd.github.io/
Last seen:
3 weeks, 4 days ago
Joined:
1 year, 3 months ago
Email:
y*****@gmail.com

Posts by yztxwd

<prev • 71 results • page 1 of 8 • next >
1
vote
0
answers
157
views
0
answers
Comment: C: Intersecting unbalanced BED files, normalizing for one
... you can use `bedtools intersect` with `-wa` option to report the intersected promoter for each interval, then use `sort -u` to get the unique promoter entry ...
written 6 months ago by yztxwd380
0
votes
2
answers
211
views
2
answers
Answer: A: How to swap the headers between fasta files ?
... parallel --xapply echo ::: $(sed 'n;d' file2.fa) ::: $(sed '1d; n; d' file1.fa) | tr ' ' '\n' ...
written 8 months ago by yztxwd380
0
votes
1
answer
214
views
1
answers
Answer: C: Enrichment Analysis for Proteins
... You can try [gprofiler][1], the tutorial can be found on its website [1]: https://biit.cs.ut.ee/gprofiler/gost ...
written 9 months ago by yztxwd380
0
votes
0
answers
305
views
0
answers
Comment: C: What if the sequence length distribution differ sharply after I use fastp to tri
... Where is the data from? The length distribution after trimming depends on a lot of things, two example 1st, If the most of your DNA fragments (before ligation) are around 60bp, the sequence reads you get will be original DNA fragment (~60bp) + adapter = 150bp Then trimming will discard the adapt ...
written 9 months ago by yztxwd380
1
vote
0
answers
305
views
0
answers
Comment: C: What if the sequence length distribution differ sharply after I use fastp to tri
... First, Per Base Sequence Content represents the proportion of ATCG at each base of the sequences, I don't know why you directly trimming to solve the problem, you should focus on if you have things like adapter contamination or some specific experiment step which will cause this kind of problem. Se ...
written 9 months ago by yztxwd380
0
votes
0
answers
216
views
0
answers
Comment: C: How to use Mantel module on jupyter notebook (python)?
... Hi, I think there are two things you can check: 1. Can you import your module in python interactive? means just type python, then import mantel 2. If you can import in pure python, is the python used by jupyter the same as the python in the 1st step? ...
written 9 months ago by yztxwd380
1
vote
1
answer
491
views
1
answers
Comment: C: Cutadapt for loop issue
... Yes! I forgot this, it's better to store old IFS, then get it back after things done old_IFS=$IFS IFS=$'\n' for sample in `cat samples.list`; do cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o ${sample}_R1_trimmed.fastq.gz -p ${sample}_R2_trim ...
written 9 months ago by yztxwd380
1
vote
1
answer
491
views
1
answers
Comment: C: Cutadapt for loop issue
... The loop processes one sample_RX.fastq.gz a time, so it is obvious that it will process R1 first, then R2 Why don't you just loop over the sample names, like for sample in `cat samples.list`; do cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o ${samp ...
written 9 months ago by yztxwd380
1
vote
0
answers
1.4k
views
0
answers
Comment: C: bedGraphToBigWig Install error
... Emm... Actually I think you can use this command because you are in the bin/ directory of this environment, if you are in another dir it should not work. If you need to use it all the time, you still need to activate the ucsc environment first anyway, cheers! ...
written 9 months ago by yztxwd380
1
vote
0
answers
1.4k
views
0
answers
Comment: C: bedGraphToBigWig Install error
... Yes, you have libssl.so.1.1, but you need libssl.so.1.0.0, so try to install openssl version 1.0 to see it can give you a libssl.so.1.0.0 in ~/anaconda2/envs/ucsc/lib I realized the old answer is too complex, you just need to try conda install -n ucsc openssl=1.0 to see if it can fix ...
written 9 months ago by yztxwd380

Latest awards to yztxwd

Rising Star 13 months ago, created 50 posts within first three months of joining.
Scholar 13 months ago, created an answer that has been accepted. For C: BWA not reporting all similar alignments
Teacher 13 months ago, created an answer with at least 3 up-votes. For C: BWA not reporting all similar alignments
Scholar 14 months ago, created an answer that has been accepted. For C: BWA not reporting all similar alignments
Scholar 15 months ago, created an answer that has been accepted. For C: BWA not reporting all similar alignments
Scholar 15 months ago, created an answer that has been accepted. For C: BWA not reporting all similar alignments
Teacher 15 months ago, created an answer with at least 3 up-votes. For A: salmon was only able to assign 0 fragments to transcripts
Teacher 15 months ago, created an answer with at least 3 up-votes. For A: salmon was only able to assign 0 fragments to transcripts

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1051 users visited in the last hour
_