User: shane.neeley

gravatar for shane.neeley
New User
Portland, Oregon
Last seen:
1 year, 9 months ago
6 years, 8 months ago

about me

Posts by shane.neeley

<prev • 25 results • page 1 of 3 • next >
Job: Seeking Bioinformatics Engineer with clinical data experience, MolecularMatch, Houston, TX, USA
... Bioinformatics Engineer, clinical data / healthcare experience needed. MolecularMatch’s Scientific team is expanding and we are looking for someone with knowledge and experience in Cancer Genomics Bioinformatics. The Bioinformatics Engineer will be involved in our ongoing projects for clinical deci ...
ngs job written 2.1 years ago by shane.neeley50
Answer: A: List Of Cloud Genomics Companies
... [][1] [1]: ...
written 2.9 years ago by shane.neeley50
Comment: C: Where Are The Genes In This Geo? How Do I See Them In R?
... Sorry. Click on the "top250" button and you will see ...
written 6.3 years ago by shane.neeley50
Answer: A: Retrieve Amino Acid Sequence From Mrna Accession Number
... I know your question is answered, but I thought I would post this script for others interested in doing iterative sequence retrievals. You can try this BioPerl E-utils script. This example is the same as searching for 'crab' in the protein database, but it will save all sequences it finds. ####### ...
written 6.6 years ago by shane.neeley50
Answer: A: Translation Of Nucleotide To Amino Acid
... Here is some python to translate all six frames of DNA. beans = "TGACTGTGTTTCTGAACAATAAATGACTTAAACCAGGTATGGCTGCCGATGGTTATCTT" gencode = { 'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M', 'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T', 'AAC':'N', 'AAT':'N', 'AAA':'K', 'AAG':'K', 'AGC ...
written 6.6 years ago by shane.neeley50
Comment: C: How Do I Make Blast Profiles? Examples Shown
... Well now I know to use blastpgp to make the profiles. ...
written 6.6 years ago by shane.neeley50
How Do I Make Blast Profiles? Examples Shown
... Hi, I was wondering if you know what commands to use on the blast command line tool, or what program to download to generate psi-blast profiles like the ones below: ...
ncbi protein blast written 6.6 years ago by shane.neeley50 • updated 4.1 years ago by Biostar ♦♦ 20
Comment: C: Calculating Solvent Accessibility With Wesa . How To Compile And Run On Os X?
... Thanks. You must be a pretty good programmer to notice that. I showed this to a very experienced C programmer and he said that it was because they paths were too long. So he edited the NNprd.c file to accept longer path lengths. So then the perl program started working with the test files. Where I a ...
written 6.6 years ago by shane.neeley50
Comment: C: How Can I Get Older Versions Of Psi-Blast Program?
... Works. But legacy version may not have been my problem after all ...
written 6.6 years ago by shane.neeley50
Comment: C: Generate Psi-Blast Profile
... Ok opened a new question. Thank you. ...
written 6.6 years ago by shane.neeley50

Latest awards to shane.neeley

Popular Question 2.1 years ago, created a question with more than 1,000 views. For Help Me Finish This Perl Code To Extract A Column In A Table
Popular Question 2.9 years ago, created a question with more than 1,000 views. For Calculating Solvent Accessibility With Wesa . How To Compile And Run On Os X?
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Help Me Finish This Perl Code To Extract A Column In A Table
Popular Question 6.3 years ago, created a question with more than 1,000 views. For Help Me Finish This Perl Code To Extract A Column In A Table


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 732 users visited in the last hour