Moderator: Jeroen Van Goey

gravatar for Jeroen Van Goey
Jeroen Van Goey2.2k
Ghent, Belgium
Last seen:
1 year, 4 months ago
7 years, 11 months ago

Just Another Genome Hacker,

Bioinformatics software developer at Applied Maths

Also known as BioGeek on the web.

Posts by Jeroen Van Goey

<prev • 60 results • page 1 of 6 • next >
7 follow
Changing the record id in a FASTA file using BioPython
... I have the following FASTA file, `original.fasta`: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need to change the record id from `foo` to `bar`, so I wrote the following code: from Bio import SeqIO original_file = r"path\to\original.fasta" corr ...
biopython written 2.5 years ago by Jeroen Van Goey2.2k • updated 9 months ago by lakshmi.bioinformatics20
dbFetch from EBI with bogus accession number returns valid record
... I'm using dbFetch from EBI in a project. I construct URLs from the format[ACCESSION_NUMBER] to retrieve sequences, e.g.: Accession numbers need to be of the format 1 letter + 5 numerals O ...
ebi dbfetch written 2.7 years ago by Jeroen Van Goey2.2k • updated 2.6 years ago by Biostar ♦♦ 20
Comment: C: Can you automatically detect if reads are from Illumina or IonTorrent?
... Input names could be changed, so I would prefer a technique that looks at the data itself. However, if that is not possible, looking at the input names might be my only/best bet.   ...
written 3.3 years ago by Jeroen Van Goey2.2k
Can you automatically detect if reads are from Illumina or IonTorrent?
... When using the SPAdes Genome Assembler, you can use either the BayesHammer read error correction tool for  Illumina reads or the IonHammer read error correction tool for IonTorrent data. I want to use SPAdes in a general workflow and I want to know if there is an automatic way to determine if reads ...
assembly spades written 3.3 years ago by Jeroen Van Goey2.2k • updated 3.3 years ago by arno.guille390
8 follow
Forum: My Friend Anthony Made This Cool Mini-Site To Find A Freelance Bioinformatics Job. Can You Help Him Out?
... What happened? Anthony (Biostar user page) will soon start on an adventure in an exciting startup, but starting 1st of October 2013, he has no real source of income. Since Anthony can not sit on his hands, he is now looking for partners to tackle exciting technical pr ...
career forum jobs job written 4.4 years ago by Jeroen Van Goey2.2k • updated 4.4 years ago by always_learning820
Answer: A: Find Sequences In Fasta File From List Of Id'S
... in the line ` records = (r for r in SeqIO.parse(input_file, "fasta") if in wanted) gives back something from the form 'gnl|TC-DB|P0A334'. So, just changing that line to records = (r for r in SeqIO.parse(input_file, "fasta") if'|')[2] in wanted) will work. I will assume th ...
written 4.9 years ago by Jeroen Van Goey2.2k
Answer: A: Retrieving Fasta Sequences From Ncbi Using Biopython
... Are you following the Entrez Usage Guidlines? Specifically: For any series of more than 100 requests, do this at weekends or outside USA peak times. This is up to you to obey. Make no more than three requests every seconds (relaxed from at most one request every three seconds in early 2009). Thi ...
written 5.0 years ago by Jeroen Van Goey2.2k
Comment: C: State Of Biostar - Future Directions (January 2013)
... As far as I know there is no such button, but you can reach the moderators via the mailinglist: ...
written 5.0 years ago by Jeroen Van Goey2.2k
Comment: C: Software For Analysis Of Bacterial Genomics.
... @/Vari: I have sent you an e-mail with some more information. ...
written 5.1 years ago by Jeroen Van Goey2.2k
Comment: C: State Of Biostar - Future Directions (January 2013)
... The project that Nikolay Vyahhi metioned that he was working on has gone live in the meantime: is a Project Euler like website with lots of small bioinformatics programming problems. It doesn't have the student/expert matching component though. ...
written 5.1 years ago by Jeroen Van Goey2.2k

Latest awards to Jeroen Van Goey

Great Question 2.4 years ago, created a question with more than 5,000 views. For Salary For A Bioinformatics Programmer In Europe?
Appreciated 3.6 years ago, created a post with more than 5 votes. For A: Free Hosting For A Bioinformatics Web Application ?
Good Answer 3.8 years ago, created an answer that was upvoted at least 5 times. For A: Free Hosting For A Bioinformatics Web Application ?
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Which Operating System Do You Prefer For Bioinformatics?
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Use Python To List Filename With Specific Extensions.
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Which Bioinformatics Tools Are Written In Python
Good Question 3.9 years ago, asked a question that was upvoted at least 5 times. For Salary For A Bioinformatics Programmer In Europe?
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Experiences With Cloud Computing In Bioinformatics
Good Answer 3.9 years ago, created an answer that was upvoted at least 5 times. For A: Helping Biostar Grow
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Recommend Your Favorite Bioinformatics Books
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: How Far Does Bioinformatics Go?
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Bioinformatic Cartoon
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Your Favorite Bioinformatics Blogs (March 2010)
Appreciated 3.9 years ago, created a post with more than 5 votes. For Salary For A Bioinformatics Programmer In Europe?
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Helping Biostar Grow
Good Answer 3.9 years ago, created an answer that was upvoted at least 5 times. For A: Free Hosting For A Bioinformatics Web Application ?
Good Answer 3.9 years ago, created an answer that was upvoted at least 5 times. For A: Which Bioinformatics Tools Are Written In Python
Good Answer 3.9 years ago, created an answer that was upvoted at least 5 times. For A: Use Python To List Filename With Specific Extensions.
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Can Biopython Parse Gzipped Xml From Blast?
Good Answer 3.9 years ago, created an answer that was upvoted at least 5 times. For A: Experiences With Cloud Computing In Bioinformatics
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Free Hosting For A Bioinformatics Web Application ?


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1952 users visited in the last hour