Moderator: Jeroen Van Goey

gravatar for Jeroen Van Goey
Jeroen Van Goey2.2k
Reputation:
2,250
Status:
Trusted
Location:
Ghent, Belgium
Website:
http://jeroen.vangoey.be/
Twitter:
@BioGeek
Last seen:
4 months, 2 weeks ago
Joined:
9 years, 8 months ago
Email:
j*************@gmail.com

Just Another Genome Hacker,

Bioinformatics software developer at Applied Maths

Also known as BioGeek on the web.

Posts by Jeroen Van Goey

<prev • 61 results • page 1 of 7 • next >
7
votes
1
answer
312
views
1
answer
Is it allowed to make a derivative work of the BioStar Handbook in another programming language?
... On the Julia forum, there was the suggestion of creating a new "flavor" of the BioStar Handbook, but using Julia as programming language for the code examples. https://discourse.julialang.org/t/biostar-handbook-computational-genomics-and-julia-to-be-or-not-to-be/25732 Is this allowed under the cu ...
julia biostar handbook written 4 months ago by Jeroen Van Goey2.2k • updated 4 months ago by Istvan Albert ♦♦ 81k
10
votes
2
answers
6.1k
views
7 follow
2
answers
Changing the record id in a FASTA file using BioPython
... I have the following FASTA file, `original.fasta`: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need to change the record id from `foo` to `bar`, so I wrote the following code: from Bio import SeqIO original_file = r"path\to\original.fasta" corr ...
biopython written 4.2 years ago by Jeroen Van Goey2.2k • updated 2.5 years ago by lakshmi.bioinformatics20
4
votes
0
answers
1.4k
views
0
answers
dbFetch from EBI with bogus accession number returns valid record
... I'm using dbFetch from EBI in a project. I construct URLs from the format https://www.ebi.ac.uk/Tools/dbfetch/emblfetch?id=[ACCESSION_NUMBER] to retrieve sequences, e.g.:  https://www.ebi.ac.uk/Tools/dbfetch/emblfetch?id=CO069431 Accession numbers need to be of the format 1 letter + 5 numerals O ...
ebi dbfetch written 4.5 years ago by Jeroen Van Goey2.2k • updated 4.4 years ago by Biostar ♦♦ 20
0
votes
1
answer
1.9k
views
1
answers
Comment: C: Can you automatically detect if reads are from Illumina or IonTorrent?
... Input names could be changed, so I would prefer a technique that looks at the data itself. However, if that is not possible, looking at the input names might be my only/best bet.   ...
written 5.0 years ago by Jeroen Van Goey2.2k
7
votes
1
answer
1.9k
views
1
answer
Can you automatically detect if reads are from Illumina or IonTorrent?
... When using the SPAdes Genome Assembler, you can use either the BayesHammer read error correction tool for  Illumina reads or the IonHammer read error correction tool for IonTorrent data. I want to use SPAdes in a general workflow and I want to know if there is an automatic way to determine if reads ...
assembly spades written 5.0 years ago by Jeroen Van Goey2.2k • updated 5.0 years ago by arno.guille400
17
votes
3
answers
4.2k
views
8 follow
3
answers
Forum: My Friend Anthony Made This Cool Mini-Site To Find A Freelance Bioinformatics Job. Can You Help Him Out?
... http://anthonyneedsajob.com/ What happened? Anthony (Biostar user page) will soon start on an adventure in an exciting startup, but starting 1st of October 2013, he has no real source of income. Since Anthony can not sit on his hands, he is now looking for partners to tackle exciting technical pr ...
career forum jobs job written 6.1 years ago by Jeroen Van Goey2.2k • updated 6.1 years ago by always_learning1000
2
votes
3
answers
3.8k
views
3
answers
Answer: A: Find Sequences In Fasta File From List Of Id'S
... r.id in the line ` records = (r for r in SeqIO.parse(input_file, "fasta") if r.id in wanted) gives back something from the form 'gnl|TC-DB|P0A334'. So, just changing that line to records = (r for r in SeqIO.parse(input_file, "fasta") if r.id.split('|')[2] in wanted) will work. I will assume th ...
written 6.6 years ago by Jeroen Van Goey2.2k
3
votes
3
answers
17k
views
3
answers
Answer: A: Retrieving Fasta Sequences From Ncbi Using Biopython
... Are you following the Entrez Usage Guidlines? Specifically: For any series of more than 100 requests, do this at weekends or outside USA peak times. This is up to you to obey. Make no more than three requests every seconds (relaxed from at most one request every three seconds in early 2009). Thi ...
written 6.8 years ago by Jeroen Van Goey2.2k
0
votes
13
answers
4.4k
views
13
answers
Comment: C: State Of Biostar - Future Directions (January 2013)
... As far as I know there is no such button, but you can reach the moderators via the mailinglist: biostar-central@googlegroups.com ...
written 6.8 years ago by Jeroen Van Goey2.2k
1
vote
3
answers
8.6k
views
3
answers
Comment: C: Software For Analysis Of Bacterial Genomics.
... @/Vari: I have sent you an e-mail with some more information. ...
written 6.8 years ago by Jeroen Van Goey2.2k

Latest awards to Jeroen Van Goey

Student 4 months ago, asked a question with at least 3 up-votes. For Salary For A Bioinformatics Programmer In Europe?
Great Question 3.1 years ago, created a question with more than 5,000 views. For Changing the record id in a FASTA file using BioPython
Teacher 3.1 years ago, created an answer with at least 3 up-votes. For A: Select Certain Column From Vcf File
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Changing the record id in a FASTA file using BioPython
Appreciated 3.1 years ago, created a post with more than 5 votes. For A: Free Hosting For A Bioinformatics Web Application ?
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Can you automatically detect if reads are from Illumina or IonTorrent?
Student 3.1 years ago, asked a question with at least 3 up-votes. For Provide A Book Review For "Bioinformatics Programming Using Python" By Mitchell L. Model
Epic Question 3.1 years ago, created a question with more than 10,000 views. For Salary For A Bioinformatics Programmer In Europe?
Teacher 3.1 years ago, created an answer with at least 3 up-votes. For A: Free Hosting For A Bioinformatics Web Application ?
Great Question 4.1 years ago, created a question with more than 5,000 views. For Salary For A Bioinformatics Programmer In Europe?
Appreciated 5.3 years ago, created a post with more than 5 votes. For A: Free Hosting For A Bioinformatics Web Application ?
Good Answer 5.6 years ago, created an answer that was upvoted at least 5 times. For A: Free Hosting For A Bioinformatics Web Application ?
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: How Far Does Bioinformatics Go?
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Recommend Your Favorite Bioinformatics Books
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Experiences With Cloud Computing In Bioinformatics
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Helping Biostar Grow
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Can Biopython Parse Gzipped Xml From Blast?
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Which Operating System Do You Prefer For Bioinformatics?
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Use Python To List Filename With Specific Extensions.
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Which Bioinformatics Tools Are Written In Python
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Free Hosting For A Bioinformatics Web Application ?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 676 users visited in the last hour