User: 2011101101

gravatar for 2011101101
New User
Last seen:
6 years, 7 months ago
7 years, 10 months ago

about me

Posts by 2011101101

<prev • 55 results • page 1 of 6 • next >
How To Get The"Clone_Lib"And "Clone" Information From Genbank(Ncbi)
... I want to get the"clone_lib"and "clone" information from genbank format.can you give me some advice? ...
perl python genbank written 6.8 years ago by 2011101101100
5 follow
How To Filter Blastn Results By Alignment Lenght
... I want to filter the blastn result according to cutoff "alignment length more than 50bp , the gap max length less than 50bp in the alignment region and evalue less than this ,the cdna map to genome ,the intron length less than 50bp. some blastn result in the outfmt 6 gi|312461686|gb|HP6 ...
blastn written 6.8 years ago by 2011101101100 • updated 6.8 years ago by Joseph Hughes2.8k
Why Does The Small Rna Sequencing Have Not Duplicates?
... Hi, Rcently,I have read many papers about small rna of plant,smRNA-seq is a mainly method ,but not like RNA-seq that have three duplicates,the small rna-seq not.why??? ...
small rna written 7.1 years ago by 2011101101100
Extract Upstream And Downstream Of User Defined Region From An Fasta File
... I have two file ,one is fsata,the other file has defined information like below query-id hit-id plus/minus start-site end-site query-sequence 234 chr1AL-k71-126309 1120 117769 + 30 55 GTCGCGAGAAGTCCATTGAACCTTAT 285 chr1AL-k71-126309 1120 117769 + 397 429 TGCGATACCTGG ...
fasta written 7.2 years ago by 2011101101100 • updated 7.2 years ago by Pierre Lindenbaum131k
Comment: C: Who Knows The Problem In This Perl Script
... Thank you very much ...
written 7.2 years ago by 2011101101100
Why Does Some Short-Read De Novo Assembly Tool Need The Same Length Of Sequence
... There are some assembly tool Taipan,SHARCGS,an so on.the input file need the sequence have the same length,why? My sequence between 20-30bp,which tool or soft can I use ? thank you ...
assembly written 7.2 years ago by 2011101101100 • updated 7.2 years ago by Joseph Hughes2.8k
Comment: C: Who Knows The Problem In This Perl Script
... thank you very much ...
written 7.2 years ago by 2011101101100
5 follow
Who Knows The Problem In This Perl Script
... $ perl 2.gff out.fasta [table_file] file.out fasta_file Use of uninitialized value $m in string ne at line 109, <GEN0> line 1. How to change it? ...
perl written 7.3 years ago by 2011101101100 • updated 7.2 years ago by kzarns30
Answer: A: Expressed Sequences Tags For Identifying Mirna Promoters
... there is another paper Characterization and Identification of MicroRNA Core Promoters in Four Model Species perhaps it's help you ...
written 7.6 years ago by 2011101101100
Comment: C: Looking For A Script To Reformat A Biological Data File
... Yes,this code is easy to me,and it's very help me to learn perl. ...
written 7.6 years ago by 2011101101100

Latest awards to 2011101101

Supporter 6.7 years ago, voted at least 25 times.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 921 users visited in the last hour