User: skm770

gravatar for skm770
skm770140
Reputation:
140
Status:
New User
Location:
Last seen:
3 years, 7 months ago
Joined:
4 years, 9 months ago
Email:
7***@biostars.org

about me

Posts by skm770

<prev • 49 results • page 1 of 5 • next >
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Ideal Way Of Calculating Dna Methylation Of A Region (E.G: Exon/Promoter)
... I was thinking that rather than taking the average of a region I would divide it by the total number of Cpg recognized in hg19 genome at that position. Would that be the right thing to do with this data set. ...
written 3.6 years ago by skm770140
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Ideal Way Of Calculating Dna Methylation Of A Region (E.G: Exon/Promoter)
... I apologize I had wrongly written the processed information that I calculated which is basically the average over a region. I have updated the question with correct info. ...
written 3.6 years ago by skm770140
0
votes
1
answer
1.8k
views
1
answer
Ideal Way Of Calculating Dna Methylation Of A Region (E.G: Exon/Promoter)
... Hi I am trying to use a public dataset which does not have coverage information chr1 10468 10470 0.895333 chr1 10470 10472 0.895967 chr1 10483 10485 0.99393 What is the best/ideal way to calculate regioinal level hai to information? There are certain tools like roimethsta ...
written 3.6 years ago by skm770140 • updated 3.6 years ago by Devon Ryan73k
0
votes
0
answers
1.4k
views
0
answers
Comment: C: How To Get The Size Of Sv With Respect To Breakdancer Output
... Since the above line of deletion is only for the treated condition. So Should I add 1842 or subtract 1842 from the respective position to get the putative region of deletion. That's my question. thanks PS: Most of these tools are not published apart from CREST so I am wary of using them. ...
written 3.7 years ago by skm770140
1
vote
0
answers
1.4k
views
0
answers
How To Get The Size Of Sv With Respect To Breakdancer Output
... Hi following is the break-dancer output example of a deletion using a normal and treated condition for a genome. Chr1 Pos1 Orientation1 Chr2 Pos2 Orientation2 Type Size Score num_Reads num_Reads_lib addRG_HN002.bam addRG_nanomax_pe.bam Gm01 2613378 16 ...
output written 3.7 years ago by skm770140
0
votes
0
answers
1.6k
views
0
answers
Comment: C: Problems With Breakdancer
... I just checked it and it shows no reads mapped. I ran it using bwa-mem with default options looks like I need to try some other aligners ...
written 3.8 years ago by skm770140
0
votes
0
answers
1.6k
views
0
answers
Comment: C: Problems With Breakdancer
... 172343366 + 0 in total (QC-passed reads + QC-failed reads) 0 + 0 duplicates 0 + 0 mapped (0.00%:-nan%) 172343366 + 0 paired in sequencing 86171683 + 0 read1 86171683 + 0 read2 0 + 0 properly paired (0.00%:-nan%) 0 + 0 with itself and mate mapped 0 + 0 singletons (0.00%:-nan%) 0 + 0 with mate mapped ...
written 3.8 years ago by skm770140
3
votes
1
answer
2.3k
views
1
answer
Create Your Own Exon/Intron/Utr Bed File Similar To That Created By Ucsc Without Using Ucsc Browser
... The genome that I am working on is not enlisted in the UCSC browser. Are there available tools that I can use to create the exon,intron and utr bed files that are produced by UCSC table browser. This is the format that UCSC produces :- chr1 14361 14829 NR_024540_utr3_0_0_chr1_14362_r 0 ...
ucsc cds exon utr intron written 3.8 years ago by skm770140 • updated 3.8 years ago by Alex Reynolds21k
0
votes
0
answers
1.6k
views
0
answers
Comment: C: Problems With Breakdancer
... Here is how one of the reads look like :- HWI-700167R:491:C2YC8ACXX:3:1101:10000:12770 77 * 0 0 * * 0 0 AATTTAACTGGTTCAATATCAGAGTACAATCTTACAACAGGAATTTTATTTCTTTGAAAAAAAATATAAGCAAAAATATTTAGCTAATGCAATAGGGGCA CCCFFFFFHGHFHJJJJJJJJIGIEHIHIJIIIJJHIJJIJ ...
written 3.8 years ago by skm770140
0
votes
0
answers
1.6k
views
0
answers
Comment: C: Problems With Breakdancer
... Hi here is the header of bam file : - @HD VN:1.4 SO:coordinate @SQ SN:Gm01 LN:55915595 @SQ SN:Gm02 LN:51656713 @SQ SN:Gm03 LN:47781076 @SQ SN:Gm04 LN:49243852 @SQ SN:Gm05 LN:41936504 @SQ SN:Gm06 LN:50722821 ........................................... ...
written 3.8 years ago by skm770140

Latest awards to skm770

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 616 users visited in the last hour