User: rob.costa1234

gravatar for rob.costa1234
rob.costa1234120
Reputation:
120
Status:
Trusted
Location:
United States
Last seen:
3 days, 6 hours ago
Joined:
4 years, 6 months ago
Email:
r************@gmail.com

about me

Posts by rob.costa1234

<prev • 86 results • page 1 of 9 • next >
0
votes
1
answer
105
views
1
answers
Comment: C: general question about strand D and R
... If I quary Myc to etract upstream/ downstream -2000 bp sequence in RSAT (http://rsat.sb-roscoff.fr/retrieve-ensembl-seq_form.cgi) the first few lines are: >Homo_sapiens-ENSG00000136997-MYC-ENST00000259523 ENSG00000136997-ENST00000259523; upstream from -2000 to -1; size: 2000; locatio ...
written 4 days ago by rob.costa1234120
1
vote
1
answer
105
views
1
answer
general question about strand D and R
... I have a very simple question- if after genomics coordinate letter D and R mentioned, that means D is forward strand, R is reverse strand? AM I correct? Thanks ...
sequence written 4 days ago by rob.costa1234120 • updated 3 days ago by glihm460
0
votes
0
answers
125
views
0
answers
variant calling by GATK question about alignment
... I have a human whole genome sequence data and I would like to call SNPs/ Indels/ mutations using GATK best practice module. Can I use Bowtie 2 for alignment. Which particular genome I have to use, Does GATK work with GRCH38 or hg19. I have tried to use hg19 as reference genome and GATK gave and erro ...
gatk alignment written 7 days ago by rob.costa1234120 • updated 7 days ago by ijaz786besanttech0
0
votes
2
answers
157
views
2
answers
Comment: C: motif in set of genes
... fimo --oc . --verbosity 1 --bgfile db/ucsc_hg19.fna.bfile --thresh 1.0E-4 motifs.meme db/ucsc_hg19.fna The command for running FIMO, If that is helpful ...
written 12 days ago by rob.costa1234120
0
votes
2
answers
157
views
2
answers
Comment: A: motif in set of genes
... Version 4.12.0, hg19 default settings ...
written 12 days ago by rob.costa1234120
0
votes
2
answers
157
views
2
answers
Comment: C: motif in set of genes
... # motif_id motif_alt_id sequence_name start stop strand score p-value q-value matched_sequence 2 KI270742.1 15757 15785 - 49.5258 2.77e-19 4.86e-14 CTCTGTCGCCCAGGCTGGAGTGCAGTGGC 2 KI270755.1 21577 21605 - 49.5258 2.77e-19 4.86e-14 CTCTGTCGCCCAGGCTGGAGTGCAGTGGC 2 KI270714.1 2 ...
written 12 days ago by rob.costa1234120
0
votes
2
answers
157
views
2
answers
Comment: C: motif in set of genes
... Motif ID Alt ID Sequence Name Strand Start End p-value q-value Matched Sequence 2 16 - 52723 52751 2.77e-19 4.86e-14 CTCTGTCGCCCAGGCTGGAGTGCAGTGGC 2 17 - 78101 78129 2.77e-19 4.86e-14 CTCTGTCGCCCAGGCTGGAGTGCAGTGGC 2 17 - 100740 100768 2.77e-19 4.86e-14 ...
written 12 days ago by rob.costa1234120
1
vote
2
answers
157
views
2
answers
motif in set of genes
... I have identified a motif from my chipseq experiment and want to find location of binding sites of such motif in my 10 genes of interests. What should be the best way or tool to do this task. Thanks ...
chip-seq written 12 days ago by rob.costa1234120 • updated 10 days ago by simon.vanheeringen50
3
votes
1
answer
116
views
1
answer
genome of rabbit
... I am looking for Rabbit genome that I want to use to create Star index for RNAseq analaysis. I genome does not have this. Any pointer where I can find it. ...
rna-seq written 25 days ago by rob.costa1234120
0
votes
0
answers
124
views
0
answers
Comment: C: linux note book
... I think Jean-Karim Heriche reply provided me the answer. jrj.healey's reply was also helpful ...
written 29 days ago by rob.costa1234120

Latest awards to rob.costa1234

Popular Question 10 months ago, created a question with more than 1,000 views. For Cnv Analysis Of Complete Genomic Data
Great Question 12 months ago, created a question with more than 5,000 views. For Gff Or Bed File For Hg19 Genome
Popular Question 16 months ago, created a question with more than 1,000 views. For Complete Genomic Vcf File
Popular Question 23 months ago, created a question with more than 1,000 views. For Complete Genomic Vcf File
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Gff Or Bed File For Hg19 Genome
Popular Question 3.8 years ago, created a question with more than 1,000 views. For Bioinformatics Cores: How To Maintain Confidentiality Of Data
Appreciated 4.5 years ago, created a post with more than 5 votes. For Bioinformatics Cores: How To Maintain Confidentiality Of Data
Good Question 4.5 years ago, asked a question that was upvoted at least 5 times. For Bioinformatics Cores: How To Maintain Confidentiality Of Data
Student 4.5 years ago, asked a question with at least 3 up-votes. For Bioinformatics Cores: How To Maintain Confidentiality Of Data

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1376 users visited in the last hour