User: hosseinv

gravatar for hosseinv
New User
Last seen:
5 years, 11 months ago
7 years, 2 months ago

about me

Posts by hosseinv

<prev • 34 results • page 1 of 4 • next >
Answer: A: SNP genotyping for few SNPs over 500 samples
... Thank you Floris. Your confirmation help me get on proceeding with my application. Appreciated. Best, Hossein  ...
written 6.0 years ago by hosseinv20
SNP genotyping for few SNPs over 500 samples
... Hi, I was wondering if someone could tell me about a recent SNP genotyping method for FEW snps but over fairly large (500) samples. I did some whole genome sequencing in the past few months where I used Illumina preps protocol for that, but have no idea about methods for genotyping only few SNPs ? ...
genotyping written 6.0 years ago by hosseinv20
Comment: C: Extracting subset of records from FASTA/FASTQ files based on exact/pattern match
... Dear Umer, I want to extract a subset of sequences in a number of fasta files (each is a gene with same samples), and I came across with the following code your wrote at your webpage: cat IDs.txt | awk '{gsub("_","\\_",$0);$0="(?s)^>"$0".*?(?=\\n(\\z|>))"}1' | pcregrep -oM -f - ...
written 6.2 years ago by hosseinv20 • updated 6 months ago by RamRS27k
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... THANK YOU, it works well now! Best, H ...
written 6.2 years ago by hosseinv20 • updated 6 months ago by RamRS27k
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... Thank you for modifying the script. This time the code was run with no error, yet the output is slightly different from what should be. Here is the output by the code (please note the third entry) >A00120 ATTTGATTTCTCATGCTAAACATTTATTGGTG >A00122 TCTGTCGACGGCAACTGTGAAACTTATCAGT ...
written 6.2 years ago by hosseinv20 • updated 6 months ago by RamRS27k
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... I edited the second file in a text editor, and the warning message gone. But, line 12 still gives me the error; Error in match(paste(">", b$V2, sep = ""), sub, nomatch = 0) : 'match' requires vector arguments ...
written 6.2 years ago by hosseinv20 • updated 6 months ago by RamRS27k
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... At line 9, it gives me the following warning: Warning message: In read.table(file = file, header = header, sep = sep, quote = quote, : incomplete final line found by readTableHeader on 'file_2.txt' At line 12, I have this error below: Error in match(paste(">", b$V2, sep = "" ...
written 6.2 years ago by hosseinv20 • updated 6 months ago by RamRS27k
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... Thank you Pierre, I used simply the paste command and it's done. Regards ...
written 6.2 years ago by hosseinv20
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... Thanks Sukhdeep Singh, I get an error at line 8, might be because I have an older version of R. I've done it somehow like the way Pierre wrote. Best ...
written 6.2 years ago by hosseinv20 • updated 6 months ago by RamRS27k
Comment: C: Rename entries of file_1 using their corresponding ids in file_2
... I'm still in the beginning of scripting. Know a bit of shell, and perl. ...
written 6.2 years ago by hosseinv20

Latest awards to hosseinv

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1962 users visited in the last hour