User: agtbeeman

gravatar for agtbeeman
agtbeeman0
Reputation:
0
Status:
New User
Last seen:
5 days, 22 hours ago
Joined:
3 weeks, 5 days ago
Email:
v************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by agtbeeman

<prev • 10 results • page 1 of 1 • next >
0
votes
1
answer
84
views
1
answers
Comment: C: Remove reads containing a specific sequence.
... Thank you genomax ! it deleted all the reads containing the sequence. However it has deleted 400,000 reads instead of 167,498. I am not sure bu I think it is relative to k-mer size I set it to maximum and it has deleted 300,000 reads. (which is better than fastx !) But if it has deleted also reads ...
written 17 days ago by agtbeeman0
2
votes
1
answer
84
views
1
answer
Remove reads containing a specific sequence.
... Hello guys, I have a sample.fastq file containing 20,000,000 reads. After doing a fastqc I notice an over-represented sequence "GGTCATCTGCAAGTGATTTTACTTCCGCCTAGTGAGAAGTGGAACAATTA" with a count of 50,000 according to fastqc. For some reasons I am interested to persue an analysis without the reads ...
software error sequence rna-seq written 17 days ago by agtbeeman0
0
votes
2
answers
148
views
2
answers
Comment: C: I have more reads after extracting those that are mapped...
... Honestly I am a bit lost. For me there is a problem in both R1 and R2 since I expect 62,31% +22,41 % of the total that is to say 22510215+8106913 = 30617128 reads in each R1 and R2 fq files. I ran also a flagtest on the sorted bam (previous running samtools fastq) : 0 + 0 secondary 0 + 0 ...
written 21 days ago by agtbeeman0
0
votes
2
answers
148
views
2
answers
Comment: C: I have more reads after extracting those that are mapped...
... Thanks I have tried this exact command. When i do count the number of reads for file3, I get 35354937 reads for R1 and 35328712 for R2 (shouldn't it be the same number ?). Do you know to which reads it corresponds to ?( cf my bowtie stats [bowtie.stats_file3][1] ). Ideally I would like to onl ...
written 22 days ago by agtbeeman0
0
votes
2
answers
148
views
2
answers
Comment: C: I have more reads after extracting those that are mapped...
... Mmmh I don't understand my output bam files are heavier than the input file ... And when I try to sort it I get error: "samtools sort: truncated file. Aborting" (edit it 's because the output is a sam fil i fixed it with -b option) ...
written 24 days ago by agtbeeman0
0
votes
2
answers
148
views
2
answers
Comment: C: I have more reads after extracting those that are mapped...
... Ok thank you so I m doing : samtools view -F 256 input.bam > output.bam then I sort the bam and run bam2fastq. Do you know if can use this command directly on my sorted.bam files ? That would make be gain a lot of time ! ...
written 24 days ago by agtbeeman0
0
votes
2
answers
148
views
2
answers
Comment: C: I have more reads after extracting those that are mapped...
... Thank you for the explanation ! However I don't see any mention of aligned options nor primary alignment in the doc you gave me ! ...
written 24 days ago by agtbeeman0
1
vote
2
answers
148
views
2
answers
I have more reads after extracting those that are mapped...
... Hello here, I have 10 samples : file1_R1.fq file1_R2.fq ... file10_R1.fq file10_R2.fq And also a Trinity.fasta file. I would like to extract from my reads file, the paired reads that are mapped to Trinity.fasta. I first ran bowtie (that shows the right amount o ...
software error alignment sequence rna-seq written 24 days ago by agtbeeman0 • updated 24 days ago by finswimmer14k
0
votes
1
answer
114
views
1
answers
Comment: C: How to have the count of reads mapping each transcript of a fasta file ?
... It is RNA seq. From my reads files I got an assembly Trinity.fasta. I am working now on a subset of the Trinity.fasta : subset.fasta. And now I have 10 .bam files that I got thanks to bowtie2 (using as inputs all the reads and subset.fasta). ...
written 26 days ago by agtbeeman0
2
votes
1
answer
114
views
1
answer
How to have the count of reads mapping each transcript of a fasta file ?
... Hi everybody, I am new to bioinformatics and I am following a de novo transcriptom assembly workflow. I have about 20 paired end fastq files (10*2 files). The assembly has finished and I got a Trinity.fasta as output. I am now working on a susbset of interested transcripts in a fasta file : subset. ...
alignment rna-seq written 26 days ago by agtbeeman0 • updated 26 days ago by h.mon31k

Latest awards to agtbeeman

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1208 users visited in the last hour