User: 2001linana

gravatar for 2001linana
2001linana20
Reputation:
20
Status:
New User
Location:
Last seen:
1 month ago
Joined:
3 months, 3 weeks ago
Email:
2*********@163.com

Posts by 2001linana

<prev • 67 results • page 1 of 7 • next >
0
votes
1
answer
131
views
1
answers
Comment: C: How to understand this piece of data from COVID19 data portal?
... One more thing, when I check the data from the link, https://www.covid19dataportal.org/sequences?db=embl-covid19, looks like it is in a table/tabular format. While on the other hand, when I download it from that provided link, it is in a txt file. I was wondering, is there any other way to obtain t ...
written 8 weeks ago by 2001linana20
0
votes
1
answer
131
views
1
answer
How to understand this piece of data from COVID19 data portal?
... Hi. I downloaded a sequences data file (of size 2.7 GB) from this link: https://www.covid19dataportal.org/sequences?db=embl-covid19. It is a .txt file and the lines for the first item/sequence is as the following: ID MW281864; SV 1; linear; genomic RNA; STD; VRL; 29871 BP. XX AC M ...
sequence written 8 weeks ago by 2001linana20 • updated 8 weeks ago by GenoMax96k
0
votes
1
answer
398
views
1
answers
Comment: C: where do you download SARS-CoV-2 sequences data ?
... Hi, I just downloaded a huge file (2GB) from COVID19 data portal. I was wondering, do you happen to know any links or references for the initial processing of the sequences data from COVID19 data portal ? ...
written 8 weeks ago by 2001linana20
0
votes
1
answer
237
views
1
answer
is it possible to transfer an amino acid sequence back into a nucleotide sequence using either blastx or tblastn?
... Hi. I have downloaded two files with name allprot0105.fasta and spikeprot0105.fasta from the GISAID main website. After inspections, I have found that both of them are for amino acid sequences, as the following characters demonstrate. > allprot0105.fasta: > >NSP1|hCoV-19/Wuhan/WIV ...
sequence sequencing written 8 weeks ago by 2001linana20 • updated 8 weeks ago by Pierre Lindenbaum134k
1
vote
0
answers
126
views
0
answers
is the sequences data in GISAID updated ?
... I logged in to the GISAID website, and found the sequences data there are as the following: it has four files, i.e., readme FASTA header format, allprot0104(57MB), spikeprot0104(6MB), nextregions. Among these, readme FASTA header format, allprot0104(57MB) and spikeprot0104(6MB) are under the Alignme ...
sequence written 8 weeks ago by 2001linana20
1
vote
0
answers
152
views
0
answers
how to open / access a .mat file in matlab ?
... Hi. I hope this is a appropriate place to ask this question, because it feels like a matlab question. So, I have the following piece of code, clear; load('metadata.mat'); seqF = fastaread('nCoV_align_trim_0310.fas'); ...
sequence written 8 weeks ago by 2001linana20 • updated 8 weeks ago by GenoMax96k
4
votes
4
answers
224
views
6 follow
4
answers
How to parse a .fasta file in python ?
... I have a .fasta file which formats like this: >NC_045512.2 |Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT CACGCAGTATAAT ...
fasta python sequence written 8 weeks ago by 2001linana20 • updated 8 weeks ago by trausch1.6k
0
votes
0
answers
136
views
0
answers
what is single-vertex fixation probability ?
... I was reading an article with title "birth-death models of information spread in structured populations" lately and have a few questions as the following. So, it is a discrete time process in which, at each iterate, a vertex is chosen, biased by fitness, to "reproduce". Then, an adjacent vertex is c ...
sequencing written 8 weeks ago by 2001linana20
0
votes
0
answers
187
views
0
answers
Forum: where to get the site mutation rate of SARS-CoV-2?
... I'd like to do some research on the mutation rate (the changing exact number with respect to time, and geography locations) of SARS-CoV-2. Could you kindly provide some reference links? Many thanks. ...
forum sequence sequencing written 10 weeks ago by 2001linana20 • updated 8 weeks ago by sarmianjuriya0
0
votes
2
answers
415
views
2
answers
Comment: C: how to batch download SARS-CoV-2 sequences data from NCBI?
... Many thanks for your kind reply. Could you be a bit more specific then? Many thanks. ...
written 3 months ago by 2001linana20

Latest awards to 2001linana

Rising Star 3 months ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2348 users visited in the last hour
_