Moderator: Charles Warden

gravatar for Charles Warden
Charles Warden7.7k
Reputation:
7,660
Status:
Trusted
Location:
Duarte, CA
Website:
https://sites.google.c...
Twitter:
@cwarden45
Scholar ID:
Google Scholar Page
Last seen:
23 hours ago
Joined:
6 years, 12 months ago
Email:
c********@gmail.com

I am a Bioinformatics Specialist at City of Hope, where I work in the Integrative Genomics Core doing microarray and high-throughput sequencing analysis.

However, the feedback that I provide represent my own personal opinions.

Posts by Charles Warden

<prev • 1,031 results • page 1 of 104 • next >
1
vote
2
answers
182
views
2
answers
Comment: C: What is the current standard for HLA allele typing prediction from SNP data?
... It would probably be best to look for similar results in more samples. However, what I can say is that different methods had similar results for the HLA-A, HLA-B, and HLA-C genes for myself, but I got different results for the HLA-D genes. If you consider the HLA types defined from the 2 SNPs, tha ...
written 6 days ago by Charles Warden7.7k
0
votes
3
answers
2.6k
views
3
answers
Comment: C: Converting TPM to FPKM
... I think the concern is that you may not be able to directly convert them. For example, I may calculate FPKM from unique alignments from htseq-count and CPM from the sum of transcript counts for the same gene (with estimations that try to correctly assign multi-mapped genes). In that situation, I c ...
written 19 days ago by Charles Warden7.7k
1
vote
7
answers
337
views
7
answers
Answer: A: Is there any online course for bioinformatics right now or in the next two or th
... I have some notes on courses that I have either taken or are considering taking in the future: http://cdwscience.blogspot.com/2019/12/experiences-with-on-line-courses.html I am not sure what level of analysis you are trying to obtain proficiency in. I have some notes on a couple JHU Coursera Data ...
written 28 days ago by Charles Warden7.7k
0
votes
5
answers
2.1k
views
5
answers
Comment: C: Calling Single-Barcode Samples from Mixed Runs as Dual-Barcode Samples | Possibl
... **Update (4/28/2010)**: When I was BLASTing an assembly, I noticed that the issue of non-PhiX top BLAST hits for PhiX sequence has come up again. As of today, I could see that for this sequence: >PhiX_test CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT Unfortuna ...
written 29 days ago by Charles Warden7.7k
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Gencove Open and free API. Any DNA data from any type to VCF in 10 to 30 mins.
... FYI, I have completed some testing with STITCH, which I think looks reasonable good (as an open-source option, given that Gencove will require a license after the free trial, and they check to get some sense of how many samples you will process during that free trial): ![enter image description her ...
written 7 weeks ago by Charles Warden7.7k
1
vote
1
answer
261
views
1
answers
Comment: C: Is it still worth it to pursue a Ph.D. degree in Bioinformatics?
... In general, there are some jobs where I would expect less change/research, such as a PhD in Clinical Psychology becoming a Psychologist (even though there are now a lot of social workers with a MSW or other qualification to be a Licensed Clinical Social Worker). I think the minimum requirement for ...
written 3 months ago by Charles Warden7.7k
1
vote
1
answer
261
views
1
answers
Comment: C: Is it still worth it to pursue a Ph.D. degree in Bioinformatics?
... Thank you for the response. However, I think Lior's tweet may have been misunderstood. He is calling such an application *pseudoscience* because of the likelihood that individuals can make claims that are not actually very robust and/or have limited predictive power. While it would be desirable t ...
written 3 months ago by Charles Warden7.7k
0
votes
1
answer
261
views
1
answers
Comment: C: Is it still worth it to pursue a Ph.D. degree in Bioinformatics?
... I apologize that I don't have more specific advice to provide. In industry, my understanding is that experience can help. For example, I thought that I have seen jobs where you might be able to get a job with a PhD in Bioinformatics or an MS in Bioinformatics + 5-10 years of experience. For other ...
written 3 months ago by Charles Warden7.7k
1
vote
1
answer
261
views
1
answers
Answer: A: Is it still worth it to pursue a Ph.D. degree in Bioinformatics?
... I've dropped out of 2 PhD programs, and I am still debating a somewhat similar question. I think finding the right way to represent your abilities is important. So, if you have concerns about the ability to build off what you are doing for long-term plans, then I think you should take that serious ...
written 3 months ago by Charles Warden7.7k
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Gencove Open and free API. Any DNA data from any type to VCF in 10 to 30 mins.
... Thank you! I sent them an e-mail (to **support@gencove.com**) relatively recently (I believe a little less than a month ago) with a slightly different question (even though it contained a portion asking about free use of GENCOVE), and I haven't heard back. I am thinking about looking into the free ...
written 3 months ago by Charles Warden7.7k

Latest awards to Charles Warden

Teacher 3 months ago, created an answer with at least 3 up-votes. For A: splice site mutations
Scholar 3 months ago, created an answer that has been accepted. For A: Validating Predictions Of Small Insertions / Deletions
Scholar 4 months ago, created an answer that has been accepted. For A: Validating Predictions Of Small Insertions / Deletions
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: splice site mutations
Scholar 5 months ago, created an answer that has been accepted. For A: Publications for individualized medicine in cancer by whole genome, exome or tra
Oracle 5 months ago, created more than 1,000 posts (questions + answers + comments).
Scholar 5 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 6 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 6 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Scholar 7 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Popular Question 9 months ago, created a question with more than 1,000 views. For Memory Allocation for VarScan
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Scholar 9 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 10 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Scholar 10 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 11 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 11 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Scholar 11 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 12 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Scholar 14 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Is it good idea to use two different quatification methods from TCGA at same tim
Scholar 15 months ago, created an answer that has been accepted. For A: Is it good idea to use two different quatification methods from TCGA at same tim

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1907 users visited in the last hour