User: yifangt86

gravatar for yifangt86
yifangt860
Reputation:
0
Status:
New User
Last seen:
2 days, 16 hours ago
Joined:
4 years, 1 month ago
Email:
y******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by yifangt86

<prev • 10 results • page 1 of 1 • next >
0
votes
0
answers
134
views
0
answers
Comment: C: strand handling of of reference sequence for index
... Thanks Brian! Is it possible for you to elaborate the indexing procedure for both the forward and reverse strand, technically? What I can guess is the "-" strand is concatenated to the "+" strand to have a single string. Then, how the offsets for each chromosome are distinguished from each other (2 ...
written 20 days ago by yifangt860
1
vote
0
answers
134
views
0
answers
strand handling of of reference sequence for index
... Following my [other post,][1] I was wondering how do the short reads mappers (bwa & bowtie2) handle the "-" strand of the reference at the step to build index. As short reads are always in 5'-->3' direction for either strand, but from the mapping result SAM file there are reads mapped to both ...
0
votes
3
answers
298
views
3
answers
Comment: C: How is the FM-index built for multiple entries of a fasta file?
... Hi Rob! Thank you so much for your time answering my tedious questions. I seem to understand the algorithms described in Ben Langmead's notes you mentioned, and I should be more specific with my questions which were actually on the details of implementation. I am studying the C code at this moment t ...
written 3 months ago by yifangt860
0
votes
3
answers
298
views
3
answers
Comment: C: How is the FM-index built for multiple entries of a fasta file?
... In the past week I read some papers and [notes][1]. FM index contains 1) First column of the BWT transformed matrix (F column) which is lexicographically sorted, so only need A/C/T/G four characters; 2) The last column of BWT matrix (L column) which is the same length of the reference genome string( ...
written 3 months ago by yifangt860
0
votes
3
answers
298
views
3
answers
Answer: A: How is the FM-index built for multiple entries of a fasta file?
... Aha, d-cameron, your reply makes me feel better. My question probably only fits into category of beginners on learning the implementation of these important data structures & algorithms, which seem to be quite advanced level, at least to me. Rob's explanation helped, and I am hoping anyone provi ...
written 4 months ago by yifangt860
1
vote
3
answers
298
views
3
answers
How is the FM-index built for multiple entries of a fasta file?
... I was wondering if anybody can explain how the FM-index was created for multiple entries of a sequence file (say, fasta format for a reference genome containing multiple chromosomes). In other words, how does the FM-index distinguish different sequences in a single fasta file? While I was studying ...
software sequence code index written 4 months ago by yifangt860
0
votes
18
answers
37k
views
18
answers
Comment: C: How To Remove The Same Sequences In The Fasta Files?
... Thanks Brian! Yes, what I meant is to dedupe sequences with the original and reverse complemented sequences, and the containment of both strands.  Not sure how necassary this job is for any application like assembly, but that's another question. ...
written 20 months ago by yifangt860
0
votes
0
answers
458
views
0
answers
visualization of PE/MP reads connection on assembly
... Hello, I am looking for open source tools/script to visualize the PE/MP reads connections on assembled contigs/scaffolds. IGV or Tablet show the the abundance along the template, but I am looking for the connections of the pairs showing the relative distance in between. Here is an example, but the ...
assembly next-gen sequence visualization written 20 months ago by yifangt860
0
votes
18
answers
37k
views
18
answers
Comment: C: How To Remove The Same Sequences In The Fasta Files?
... Hello Shaun: I tried the seqmagic as you suggested, but it did not give what is expected. >seq ATCGATCGATATATATATAT >seq2 part of seq1 CGATCGATATATATATA >seq3 part of seq2 ATCGATATATAT >seq4 reverse complementary of seq 2 TATATATATATCGATCG >seq5 new seq ATCGATCGACGATCGAGCGCG >se ...
written 2.8 years ago by yifangt860
0
votes
18
answers
37k
views
18
answers
Comment: C: How To Remove The Same Sequences In The Fasta Files?
... Hello Shaun: I tried the seqmagic as you suggested, but it did not give what is expected. >seq ATCGATCGATATATATATAT >seq2 part of seq1 CGATCGATATATATATA >seq3 part of seq2 ATCGATATATAT >seq4 reverse complementary of seq 2 TATATATATATCGATCG >seq5 new seq ATCGATCGACGATCGAGCGCG >se ...
written 2.8 years ago by yifangt860

Latest awards to yifangt86

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1531 users visited in the last hour