User: jockbanan

gravatar for jockbanan
jockbanan390
Reputation:
390
Status:
Trusted
Location:
Czech Republic
Last seen:
2 weeks, 5 days ago
Joined:
7 years, 1 month ago
Email:
k*********@gmail.com

about me

Posts by jockbanan

<prev • 26 results • page 1 of 3 • next >
0
votes
1
answer
350
views
1
answers
Answer: A: CROP-seq data analysis
... I expect your data come from a 10x Genomics machine, right? This is how I do it 1) create a fasta file with reference sequences that sgRNA reads will map to. The sequences look like this: U6promoter-sgRNA1-tracrRNA U6promoter-sgRNA2-tracrRNA U6promoter-sgRNA3-tracrRNA ... where U6protomer a ...
written 6 months ago by jockbanan390
0
votes
1
answer
1.0k
views
1
answers
Comment: A: Where is the IGV hg38 gene track from
... Hi! I also thought so, but I just found some discrepancies. One example is MYC: in the current RefGene track, transcript NM_002467 has transcription end at: 127742951 In the current IGV track, transcript NM_002467 has transcription end at: 127741434 I also checked an older (August 2018) version ...
written 12 months ago by jockbanan390
4
votes
0
answers
2.4k
views
0
answers
Tool: Clustering of short peptide sequences
... Dear Biostars community,  We would like to introduce new software for peptide sequence clustering. Simply, it takes input peptide sequences, identifies clusters of peptides sharing sequence motifs, and generates multiple sequence alignments of resulting clusters. So if you have something like this: ...
peptide tool clustering phage display written 4.9 years ago by jockbanan390
0
votes
1
answer
2.7k
views
1
answers
Comment: C: Trimmomatic does not trim custom adapters in palindrome mode
... Ok, thaks for your advice. It is good to see that I'm not the only one who is confused. ...
written 5.2 years ago by jockbanan390
0
votes
1
answer
2.7k
views
1
answers
Comment: C: Trimmomatic does not trim custom adapters in palindrome mode
... I see. So Trimmomatic does not deal with gaps? But anyway, the R2 adapter aligns well, no gaps, just 2 missmatches:  *** Local alignment Scores: score=28; pos=67 cigar=32M38S Alignment: CTGTCTCTTATACGCATATGACGCTGCCGACG CTGTCTCTTATACACATCTGACGCTGCCGACG   Or do they both have to align without ...
written 5.2 years ago by jockbanan390
3
votes
1
answer
2.7k
views
1
answer
Trimmomatic does not trim custom adapters in palindrome mode
... Hi all! I have problem with Trimmomatic 0.33   I have paired-end Illumina reads. For experimenting, I used just 1 read pair, but it comes from a real dataset. So this is my R1.fastq file:  @NS500448:3:H058VAFXX:1:11101:9071:4665 1:N:0:CGTACTAG+ATAGAGAG TCTATCAACAGAGAAAGTTACGCAAAGAAAATGAGTCAAAAGT ...
software error trimmomatic next-gen written 5.2 years ago by jockbanan390 • updated 5.2 years ago by Istvan Albert ♦♦ 84k
0
votes
1
answer
3.6k
views
1
answers
Answer: A: How to cluster (nearest neighbour method) amino acid peptide sequences based on
... If it is just the matter of sequence identity, uclust/cd-hit would probably be the best. If you want to take into account biochemical properties of amino acids used, there are some more sophisticated tools out there, namely: MUSI and the Gibbs sampling tool (IMHO better than MUSI) and also Hammock ( ...
written 5.5 years ago by jockbanan390
2
votes
3
answers
4.5k
views
3
answers
Answer: A: Visualizing Hmm Files Of Hmmer3
... Skylign is now capable of that:  http://skylign.org/ ...
written 5.7 years ago by jockbanan390
2
votes
3
answers
23k
views
3
answers
Comment: C: Pca From Vcf Files
... Experienced the same issue. It seem the problem is that by default, chromosome names are not in the form "chr1" etc., but just "1" etc. The solution is to use function snpgdsOption() to redefine your chromosome names to whatever form they are in your vcf file : snpgdsVCF2GDS(vcf, "ccm.gds", method= ...
written 6.4 years ago by jockbanan390 • updated 6.4 years ago by Leszek4.0k
0
votes
1
answer
3.4k
views
1
answers
Comment: C: Multi-Sample Somatic Mutation Calling
... Exactly, false-positives are the reason. And, well, yes, I would also like to have way more samples... ...
written 6.4 years ago by jockbanan390

Latest awards to jockbanan

Teacher 9 months ago, created an answer with at least 3 up-votes. For A: How To Get The Kegg Pathway Name After Enrichment Analysis Using Kegg.Db From Bi
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Clustering of short peptide sequences
Great Question 2.7 years ago, created a question with more than 5,000 views. For Rna-Seq: Treat Samples As Biological Replicates?
Epic Question 3.5 years ago, created a question with more than 10,000 views. For Rrna Removal In Rna-Seq Data
Good Question 3.5 years ago, asked a question that was upvoted at least 5 times. For Rna-Seq: Treat Samples As Biological Replicates?
Popular Question 3.5 years ago, created a question with more than 1,000 views. For Trimmomatic does not trim custom adapters in palindrome mode
Good Question 4.0 years ago, asked a question that was upvoted at least 5 times. For Rrna Removal In Rna-Seq Data
Great Question 4.8 years ago, created a question with more than 5,000 views. For Rrna Removal In Rna-Seq Data
Popular Question 5.1 years ago, created a question with more than 1,000 views. For Rna-Seq: Treat Samples As Biological Replicates?
Appreciated 5.1 years ago, created a post with more than 5 votes. For C: Aligning Reads To A Reference Transcriptome
Appreciated 5.7 years ago, created a post with more than 5 votes. For C: Aligning Reads To A Reference Transcriptome
Student 5.9 years ago, asked a question with at least 3 up-votes. For Rna-Seq: Treat Samples As Biological Replicates?
Popular Question 6.0 years ago, created a question with more than 1,000 views. For Rna-Seq: Treat Samples As Biological Replicates?
Student 6.2 years ago, asked a question with at least 3 up-votes. For Rrna Removal In Rna-Seq Data
Popular Question 6.2 years ago, created a question with more than 1,000 views. For Rrna Removal In Rna-Seq Data
Supporter 6.3 years ago, voted at least 25 times.
Appreciated 6.8 years ago, created a post with more than 5 votes. For C: Aligning Reads To A Reference Transcriptome
Commentator 6.8 years ago, created a comment with at least 3 up-votes. For C: Aligning Reads To A Reference Transcriptome

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 693 users visited in the last hour