User: jockbanan

gravatar for jockbanan
jockbanan370
Reputation:
370
Status:
Trusted
Location:
Czech Republic
Last seen:
2 months, 1 week ago
Joined:
5 years, 3 months ago
Email:
k*********@gmail.com

about me

Posts by jockbanan

<prev • 24 results • page 1 of 3 • next >
4
votes
0
answers
1.4k
views
0
answers
Tool: Clustering of short peptide sequences
... Dear Biostars community,  We would like to introduce new software for peptide sequence clustering. Simply, it takes input peptide sequences, identifies clusters of peptides sharing sequence motifs, and generates multiple sequence alignments of resulting clusters. So if you have something like this: ...
peptide tool clustering phage display written 3.0 years ago by jockbanan370
0
votes
1
answer
1.9k
views
1
answers
Comment: C: Trimmomatic does not trim custom adapters in palindrome mode
... Ok, thaks for your advice. It is good to see that I'm not the only one who is confused. ...
written 3.4 years ago by jockbanan370
0
votes
1
answer
1.9k
views
1
answers
Comment: C: Trimmomatic does not trim custom adapters in palindrome mode
... I see. So Trimmomatic does not deal with gaps? But anyway, the R2 adapter aligns well, no gaps, just 2 missmatches:  *** Local alignment Scores: score=28; pos=67 cigar=32M38S Alignment: CTGTCTCTTATACGCATATGACGCTGCCGACG CTGTCTCTTATACACATCTGACGCTGCCGACG   Or do they both have to align without ...
written 3.4 years ago by jockbanan370
3
votes
1
answer
1.9k
views
1
answer
Trimmomatic does not trim custom adapters in palindrome mode
... Hi all! I have problem with Trimmomatic 0.33   I have paired-end Illumina reads. For experimenting, I used just 1 read pair, but it comes from a real dataset. So this is my R1.fastq file:  @NS500448:3:H058VAFXX:1:11101:9071:4665 1:N:0:CGTACTAG+ATAGAGAG TCTATCAACAGAGAAAGTTACGCAAAGAAAATGAGTCAAAAGT ...
software error trimmomatic next-gen written 3.4 years ago by jockbanan370 • updated 3.4 years ago by Istvan Albert ♦♦ 77k
0
votes
1
answer
2.6k
views
1
answers
Answer: A: How to cluster (nearest neighbour method) amino acid peptide sequences based on
... If it is just the matter of sequence identity, uclust/cd-hit would probably be the best. If you want to take into account biochemical properties of amino acids used, there are some more sophisticated tools out there, namely: MUSI and the Gibbs sampling tool (IMHO better than MUSI) and also Hammock ( ...
written 3.7 years ago by jockbanan370
2
votes
2
answers
3.5k
views
2
answers
Answer: A: Visualizing Hmm Files Of Hmmer3
... Skylign is now capable of that:  http://skylign.org/ ...
written 3.9 years ago by jockbanan370
2
votes
3
answers
16k
views
3
answers
Comment: C: Pca From Vcf Files
... Experienced the same issue. It seem the problem is that by default, chromosome names are not in the form "chr1" etc., but just "1" etc. The solution is to use function snpgdsOption() to redefine your chromosome names to whatever form they are in your vcf file : snpgdsVCF2GDS(vcf, "ccm.gds", method= ...
written 4.6 years ago by jockbanan370 • updated 4.6 years ago by Leszek3.9k
0
votes
1
answer
2.8k
views
1
answers
Comment: C: Multi-Sample Somatic Mutation Calling
... Exactly, false-positives are the reason. And, well, yes, I would also like to have way more samples... ...
written 4.6 years ago by jockbanan370
0
votes
1
answer
2.8k
views
1
answers
Comment: C: Multi-Sample Somatic Mutation Calling
... Thanks for reply, I'll stick to downstream tools then. ...
written 4.6 years ago by jockbanan370
2
votes
1
answer
2.8k
views
1
answer
Multi-Sample Somatic Mutation Calling
... Hi all! I have 4 pairs of matched tumor/normal exome sequencing experiments. These are from 4 patients with the same type of tumor. I want to detect tumor-specific somatic mutations. Looking at the documentation of SomaticSniper, VarScan, GATK somaticIndelDetector and other tools, it seems they a ...
variant-calling cancer somatic variant snp mutation written 4.6 years ago by jockbanan370 • updated 4.6 years ago by Dan Gaston7.1k

Latest awards to jockbanan

Popular Question 9 months ago, created a question with more than 1,000 views. For Clustering of short peptide sequences
Great Question 10 months ago, created a question with more than 5,000 views. For Rna-Seq: Treat Samples As Biological Replicates?
Popular Question 19 months ago, created a question with more than 1,000 views. For Trimmomatic does not trim custom adapters in palindrome mode
Epic Question 19 months ago, created a question with more than 10,000 views. For Rrna Removal In Rna-Seq Data
Good Question 19 months ago, asked a question that was upvoted at least 5 times. For Rna-Seq: Treat Samples As Biological Replicates?
Good Question 2.2 years ago, asked a question that was upvoted at least 5 times. For Rrna Removal In Rna-Seq Data
Great Question 3.0 years ago, created a question with more than 5,000 views. For Rrna Removal In Rna-Seq Data
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Rna-Seq: Treat Samples As Biological Replicates?
Appreciated 3.3 years ago, created a post with more than 5 votes. For C: Aligning Reads To A Reference Transcriptome
Appreciated 3.9 years ago, created a post with more than 5 votes. For C: Aligning Reads To A Reference Transcriptome
Student 4.1 years ago, asked a question with at least 3 up-votes. For Rna-Seq: Treat Samples As Biological Replicates?
Popular Question 4.2 years ago, created a question with more than 1,000 views. For Rna-Seq: Treat Samples As Biological Replicates?
Student 4.4 years ago, asked a question with at least 3 up-votes. For Rrna Removal In Rna-Seq Data
Popular Question 4.4 years ago, created a question with more than 1,000 views. For Rrna Removal In Rna-Seq Data
Supporter 4.5 years ago, voted at least 25 times.
Appreciated 4.9 years ago, created a post with more than 5 votes. For C: Aligning Reads To A Reference Transcriptome
Commentator 4.9 years ago, created a comment with at least 3 up-votes. For C: Aligning Reads To A Reference Transcriptome

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1800 users visited in the last hour