User: Fedster

gravatar for Fedster
Fedster20
Reputation:
20
Status:
New User
Location:
Last seen:
2 months, 1 week ago
Joined:
5 years, 7 months ago
Email:
f********@gmail.com

about me

Posts by Fedster

<prev • 19 results • page 1 of 2 • next >
1
vote
2
answers
192
views
2
answers
Comment: C: samtools: splitting a bam file putting all scaffolds together
... works, if you add it as an answer I will accept it as the correct one. Cheers ...
written 11 weeks ago by Fedster20
0
votes
2
answers
192
views
2
answers
Comment: C: samtools: splitting a bam file putting all scaffolds together
... basically `samtools view my.bam contig* -b -o output.bam` does not work ...
written 11 weeks ago by Fedster20
0
votes
2
answers
192
views
2
answers
Comment: C: samtools: splitting a bam file putting all scaffolds together
... I do not want to run all chroms and contigs in parallel, I want to get all the fragments mapping to any contig (not in a chromosome) out in one single step and dump in one single file. My problem is not listing all possible fragments/contigs/chroms, it using a wildcard in samtools view to get out s ...
written 11 weeks ago by Fedster20
8
votes
2
answers
192
views
7 follow
2
answers
samtools: splitting a bam file putting all scaffolds together
... I have some bam files that I want to split. The reference genome has 22 chromosomes and a bunch of unplaced scaffolds. I can easily split the bam files chromosome by chromososme samtools view my.bam chromsosmeI -b -o my_chromosomeI.bam I can do the same *scaffold by scaffold*, but I would li ...
splitting bam samtools scaffold written 11 weeks ago by Fedster20 • updated 11 weeks ago by finswimmer10k
0
votes
1
answer
198
views
1
answers
Comment: C: Freebayes outputs only one individual out of many
... and samtools view S-177.sorted.bam |head -n5 K00335:147:HL3KJBBXX:7:1227:25286:38627 0 MT 6894 1 64M * 0 0 CTGCTAAACGTGAAGTTTTAGCAGTTGAAATAACAACAACAAACGTCGAGTGACTTCACGGCTG JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ>JJJ AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0XG:i:0 NM:i:0 MD: ...
written 3 months ago by Fedster20
0
votes
1
answer
198
views
1
answers
Comment: C: Freebayes outputs only one individual out of many
... technically I used not just x.bam but w whole lot of bams (sorted) generated by bowtie2. Using a real sample name: samtools view -H S-177.sorted.bam |head @HD VN:1.0 SO:coordinate @SQ SN:MT LN:15742 @SQ SN:groupI LN:28185914 @SQ SN:groupII LN:23295652 @SQ SN:groupIII LN:167 ...
written 3 months ago by Fedster20
0
votes
1
answer
198
views
1
answers
Comment: A: Freebayes outputs only one individual out of many
... Ok, I tried to add RG tags and it is just basically a fail. I can add tags, but freebayes still does not like them. Given a file for ID x samtools addreplacerg -r ID:x -r SM:x -o x.bam x.sorted.bam adds a tag (at least, I can see a tag in the file and I get no error), but to no avail: ...
written 3 months ago by Fedster20
0
votes
1
answer
198
views
1
answers
Comment: C: Freebayes outputs only one individual out of many
... One thing that is not clear from bamaddrg is whether the option -L (list of files) is then needed. Is it? ...
written 3 months ago by Fedster20
0
votes
1
answer
198
views
1
answers
Comment: C: Freebayes outputs only one individual out of many
... finswimmer pointed out adding RG tags is best practice but technically not necessary. In any case I will give it a go as it is not working for me as it is. ...
written 3 months ago by Fedster20
0
votes
1
answer
198
views
1
answers
Comment: C: Freebayes outputs only one individual out of many
... #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT unknown ...
written 3 months ago by Fedster20

Latest awards to Fedster

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1303 users visited in the last hour