User: kmkdesilva

gravatar for kmkdesilva
kmkdesilva80
Reputation:
80
Status:
Trusted
Location:
United States
Last seen:
1 week, 4 days ago
Joined:
6 years, 2 months ago
Email:
k*********@gmail.com

about me

Posts by kmkdesilva

<prev • 38 results • page 1 of 4 • next >
0
votes
1
answer
118
views
1
answers
Comment: C: What is ExcessHet key in the INFO field of a vcf file
... Thank you. My final understanding is I need to look at the distribution of my ExcessHet values in the vcf file and then determine a z-score. Based on that z-score I can find the cut off ExcessHet value. Please let me know if I am wrong. ...
written 5 weeks ago by kmkdesilva80
1
vote
1
answer
118
views
1
answer
What is ExcessHet key in the INFO field of a vcf file
... Hi, Following is a single line from a vcf file I have (there are about 90 samples, so I omitted that part) chr1 3463 . C T 59.40 . AC=2;AF=0.143;AN=14;DP=13;ExcessHet=0.1703;FS=0.000;MLEAC=2;MLEAF=0.143;MQ=26.38;QD=29.70;SOR=2.303 GT:AD:DP:GQ:PGT:PID:PL 1. I ...
next-gen snp sequencing written 5 weeks ago by kmkdesilva80 • updated 5 weeks ago by Dave Carlson220
1
vote
1
answer
110
views
1
answers
Comment: C: How to define output for ALT tag in vcf file
... Now I understand it. Thank you everyone. ...
written 5 weeks ago by kmkdesilva80
0
votes
1
answer
110
views
1
answers
Comment: C: How to define output for ALT tag in vcf file
... Yes ATpoint that is what I wanted to know. Thank you. In the second position one of the ALT alleles is just G. Does this indicate a deletion at this position in some of the samples? ...
written 5 weeks ago by kmkdesilva80
4
votes
1
answer
110
views
1
answer
How to define output for ALT tag in vcf file
... Hi everyone, I am looking at a VCF file and at one position, under ALT I saw the following nucleotides T,GATCACGTGCCTGATCATGCACTT 1. Can someone please tell what the second ALT allele (GATCACGTGCCTGATCATGCACTT) is? In another position I see REF and ALT as following GTGATCACGTGACTGATCAT ...
next-gen snp sequencing written 5 weeks ago by kmkdesilva80 • updated 5 weeks ago by genomax73k
0
votes
1
answer
305
views
1
answers
Comment: C: How to use a single file as the input to MaSuRCA
... I am sorry for the confusion. I extracted the k-mers which are common among my genome of interest and several other genomes from closely related species. I am going to do a introgression study. ...
written 7 months ago by kmkdesilva80
0
votes
1
answer
305
views
1
answers
Comment: C: How to use a single file as the input to MaSuRCA
... Thank you very much for the clarification. I am new for this kind of analysis. I thought I should assemble the k-mers but now I understand that I need to find the corresponding reads. I highly appreciate if you can you please tell me how to go back to my data and find the corresponding reads. ...
written 7 months ago by kmkdesilva80
1
vote
1
answer
305
views
1
answer
How to use a single file as the input to MaSuRCA
... Hi everyone, I generated k-mers of a certain region of my genome of interest using Jellyfish software. Next I extracted certain k-mers from the dump.fa out put file. Now I need to assemble these k-mers into contigs. I read the documentation of MaSuRCA. It need to input files (ex: R1.fa and R2.fa). ...
assembly masurca input written 7 months ago by kmkdesilva80 • updated 7 months ago by shelkmike130
0
votes
0
answers
210
views
0
answers
How to understand data in custom track of ucsc genome browsers
... Hi everyone, I am looking at these custom tracks for whole genome sequence of a zebra on ucsc genome browser. It is mapped against horse reference genome. To my understanding the red track is the forward strand of zebra and blue track is the reverse strand of zebra. I want to get the paired end rea ...
genome custom track ucsc genome browser sequence written 7 months ago by kmkdesilva80
0
votes
1
answer
4.9k
views
1
answers
Comment: C: Samtools give this error
... Yayy Thank you :D Does it give an error file even it runs correctly. ...
written 3.3 years ago by kmkdesilva80

Latest awards to kmkdesilva

Epic Question 7 months ago, created a question with more than 10,000 views. For How To Install Fastx-Toolkit
Great Question 3.2 years ago, created a question with more than 5,000 views. For How To Install Fastx-Toolkit
Epic Question 3.2 years ago, created a question with more than 10,000 views. For Understanding Fastqc Output- Please Help
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Tools Used For Inferring Phylogenetic Relationships Using Next Generation Data Set
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Bioinformatics Tools For Rad-Seq Data
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Converting .Bcl To Fasta
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Why 3' End Has A Lower Quality In Ngs Data
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Tools To Draw Bayesian Trees
Popular Question 3.2 years ago, created a question with more than 1,000 views. For What Are Double Digest Rad Data? How Are They Generated?
Supporter 3.3 years ago, voted at least 25 times.
Great Question 3.5 years ago, created a question with more than 5,000 views. For Understanding Fastqc Output- Please Help
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Tools Used For Inferring Phylogenetic Relationships Using Next Generation Data Set
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Converting .Bcl To Fasta
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Bioinformatics Tools For Rad-Seq Data
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Which Tree Is Better In Mega Output
Popular Question 4.0 years ago, created a question with more than 1,000 views. For How To Edit A Phylip File To Align In Mega
Popular Question 5.7 years ago, created a question with more than 1,000 views. For Tools Used For Inferring Phylogenetic Relationships Using Next Generation Data Set
Popular Question 5.7 years ago, created a question with more than 1,000 views. For Understanding Fastqc Output- Please Help
Popular Question 5.7 years ago, created a question with more than 1,000 views. For Gbs And Rad Data
Popular Question 5.7 years ago, created a question with more than 1,000 views. For How To Install Fastx-Toolkit

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 763 users visited in the last hour