User: kmkdesilva

gravatar for kmkdesilva
kmkdesilva80
Reputation:
80
Status:
Trusted
Location:
United States
Last seen:
1 week, 1 day ago
Joined:
6 years, 11 months ago
Email:
k*********@gmail.com

about me

Posts by kmkdesilva

<prev • 42 results • page 1 of 5 • next >
1
vote
0
answers
81
views
0
answers
Assemble A1 and A2 reads using Trinity before running blastx on them
... I have two fast file A1.fa and A2.fa for a fungi genome. I want to run blastx on these nucleotide sequences. My question is do I need to use Trinity to assemble A1.fa and A2.fa files in to a single Trinity.fa file and then run blastx on Trinity.fa file? ...
assembly blastx trinity written 23 days ago by kmkdesilva80
0
votes
0
answers
175
views
0
answers
Comment: C: Extracting Allele Frequencies at a set of given positions
... chr1 183 . GA G 547.21 . AC=6;AF=0.750;AN=8;DP=77;ExcessHet=0.3218;FS=0.000;MLEAC=54;MLEAF=1.00;MQ=47.12;MQ0=0;QD=28.73;SOR=0.693 GT:AD:DP:GQ:PL ./.:0,0:0:.:0,0,0 0/0:8,0:8:3:0,3,45 ./.:0,0:0:.:0,0,0 ./.:0,0:0:.:0,0,0 ./.:0,0:0:.:0,0, ...
written 7 months ago by kmkdesilva80 • updated 7 months ago by finswimmer13k
0
votes
0
answers
175
views
0
answers
Extracting Allele Frequencies at a set of given positions
... Hi all, I used SIFT annotator on a vcf file containing 96 animals. After annotation there is a new "SIFTINFO=" tag in the info field of the vcf file which gives the information on whether the variant is tolerated, deleterious or NA. I would like to extract the Allele Frequency(AF) at these positio ...
vcf allele frequnecy whole genome dna sequence written 7 months ago by kmkdesilva80
0
votes
0
answers
232
views
0
answers
Hard filtering vcf files
... Hi all, I am trying to find a set of variants for a non-model organism that can be used as a known set (well-curated training/truth resources) in VQSR. I have whole genome sequence bam files from 96 animals. I am thinking of doing hard filtering as advised here https://software.broadinstitute.org ...
genome variant calling hard filtering snp gatk written 7 months ago by kmkdesilva80
0
votes
1
answer
454
views
1
answers
Comment: C: What is ExcessHet key in the INFO field of a vcf file
... Thank you. My final understanding is I need to look at the distribution of my ExcessHet values in the vcf file and then determine a z-score. Based on that z-score I can find the cut off ExcessHet value. Please let me know if I am wrong. ...
written 10 months ago by kmkdesilva80
1
vote
1
answer
454
views
1
answer
What is ExcessHet key in the INFO field of a vcf file
... Hi, Following is a single line from a vcf file I have (there are about 90 samples, so I omitted that part) chr1 3463 . C T 59.40 . AC=2;AF=0.143;AN=14;DP=13;ExcessHet=0.1703;FS=0.000;MLEAC=2;MLEAF=0.143;MQ=26.38;QD=29.70;SOR=2.303 GT:AD:DP:GQ:PGT:PID:PL 1. I ...
next-gen snp sequencing written 10 months ago by kmkdesilva80 • updated 10 months ago by Dave Carlson320
1
vote
1
answer
240
views
1
answers
Comment: C: How to define output for ALT tag in vcf file
... Now I understand it. Thank you everyone. ...
written 10 months ago by kmkdesilva80
0
votes
1
answer
240
views
1
answers
Comment: C: How to define output for ALT tag in vcf file
... Yes ATpoint that is what I wanted to know. Thank you. In the second position one of the ALT alleles is just G. Does this indicate a deletion at this position in some of the samples? ...
written 10 months ago by kmkdesilva80
4
votes
1
answer
240
views
1
answer
How to define output for ALT tag in vcf file
... Hi everyone, I am looking at a VCF file and at one position, under ALT I saw the following nucleotides T,GATCACGTGCCTGATCATGCACTT 1. Can someone please tell what the second ALT allele (GATCACGTGCCTGATCATGCACTT) is? In another position I see REF and ALT as following GTGATCACGTGACTGATCAT ...
next-gen snp sequencing written 10 months ago by kmkdesilva80 • updated 10 months ago by genomax85k
0
votes
1
answer
481
views
1
answers
Comment: C: How to use a single file as the input to MaSuRCA
... I am sorry for the confusion. I extracted the k-mers which are common among my genome of interest and several other genomes from closely related species. I am going to do a introgression study. ...
written 16 months ago by kmkdesilva80

Latest awards to kmkdesilva

Great Question 9 months ago, created a question with more than 5,000 views. For How To Install Fastx-Toolkit
Epic Question 15 months ago, created a question with more than 10,000 views. For How To Install Fastx-Toolkit
Great Question 4.0 years ago, created a question with more than 5,000 views. For How To Install Fastx-Toolkit
Epic Question 4.0 years ago, created a question with more than 10,000 views. For Understanding Fastqc Output- Please Help
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Tools Used For Inferring Phylogenetic Relationships Using Next Generation Data Set
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Bioinformatics Tools For Rad-Seq Data
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Converting .Bcl To Fasta
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Why 3' End Has A Lower Quality In Ngs Data
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Tools To Draw Bayesian Trees
Popular Question 4.0 years ago, created a question with more than 1,000 views. For What Are Double Digest Rad Data? How Are They Generated?
Supporter 4.0 years ago, voted at least 25 times.
Great Question 4.2 years ago, created a question with more than 5,000 views. For Understanding Fastqc Output- Please Help
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Tools Used For Inferring Phylogenetic Relationships Using Next Generation Data Set
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Converting .Bcl To Fasta
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Bioinformatics Tools For Rad-Seq Data
Popular Question 4.7 years ago, created a question with more than 1,000 views. For Which Tree Is Better In Mega Output
Popular Question 4.7 years ago, created a question with more than 1,000 views. For How To Edit A Phylip File To Align In Mega
Popular Question 6.4 years ago, created a question with more than 1,000 views. For Tools Used For Inferring Phylogenetic Relationships Using Next Generation Data Set
Popular Question 6.4 years ago, created a question with more than 1,000 views. For Understanding Fastqc Output- Please Help
Popular Question 6.4 years ago, created a question with more than 1,000 views. For Gbs And Rad Data
Popular Question 6.4 years ago, created a question with more than 1,000 views. For How To Install Fastx-Toolkit

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1146 users visited in the last hour