User: natasha.sernova

gravatar for natasha.sernova
natasha.sernova3.7k
Reputation:
3,730
Status:
Trusted
Location:
Last seen:
1 day, 22 hours ago
Joined:
7 years ago
Email:
n**************@gmail.com

Posts by natasha.sernova

<prev • 863 results • page 1 of 87 • next >
0
votes
1
answer
192
views
1
answers
Comment: C: The SARS-CoV-2 genome alignment option
... Unfortunately some genomes are elsewhere, I had to search other dbs to find most of them. ...
written 5 months ago by natasha.sernova3.7k
2
votes
1
answer
192
views
1
answer
The SARS-CoV-2 genome alignment option
... Dear all, Nowadays many scientists have to solve some problems related to SARS-CoV-2. The viral genomes are huge(~30kb). Is it correct, that to align several of them I have to put those fasta-genomes to a single file, add a reference genome to the same file and run a proper tool like MAFFT? (lik ...
mafft mafft-l-ins-i sars-cov-2 written 5 months ago by natasha.sernova3.7k
0
votes
2
answers
1.1k
views
2
answers
Comment: A: Predicting the 3D structure of a protein
... According to this page: https://blanco.biomol.uci.edu/mpex/ it may be used. ...
written 6 months ago by natasha.sernova3.7k
0
votes
0
answers
323
views
0
answers
Comment: C: designing PCR for COVID19
... IMHO it is an important topic. Any country has at least a few patients now. And very few articles discuss experimental procedures and provide some details. Where else is it possible to find some current scientific information, if not here? Thank you! ...
written 8 months ago by natasha.sernova3.7k
0
votes
0
answers
435
views
0
answers
Comment: C: Maf to Fasta
... The following post may be helpful: https://www.biostars.org/p/386058/ Look at the right panel after you have submitted your question. You will see a lot of similar questions! ...
written 9 months ago by natasha.sernova3.7k
0
votes
1
answer
221
views
1
answers
Comment: A: GENCODE and untranslated regions
... This post looks helpful. https://www.biostars.org/p/48502/ ...
written 10 months ago by natasha.sernova3.7k
0
votes
2
answers
277
views
2
answers
Comment: C: Which gene name should I choose?
... See these posts, they may help you. The second post shows that it's not an easy question at all. Good luck! https://www.biostars.org/p/164321/ https://www.biostars.org/p/1378/ https://www.biostars.org/p/319781/ Sometimes gene name depends upon species, approach or database. https://www.biostar ...
written 11 months ago by natasha.sernova3.7k
2
votes
0
answers
251
views
0
answers
Comment: C: Update list of asseccion numbers
... There are a few posts about update of accession numbers in Biostar database, I found some, but you may continue the search if it's not enough to you. Go to the upper left corner of the page, press 'LATEST' and type your question: 'update of accession number'. In case there is no answer, replac ...
written 11 months ago by natasha.sernova3.7k
7
votes
2
answers
327
views
2
answers
Forum: How to follow a particular post on Biostars?
... Dear all! Sorry, it's a trivial question. If I like some particular post, what should I do to follow it? So far I've saved its link in a file, but is there a better way? I found just a post about following a particular post-author with many nice posts. I would like to follow a single post. How s ...
post following forum written 11 months ago by natasha.sernova3.7k • updated 9 months ago by andrewjacob4280
0
votes
2
answers
1.1k
views
2
answers
Comment: C: Python- Searching codons using for/if
... > dna = "ATGCGATCGATCGATCGATCGCGCGCGCAGCTA" for i in range(0, len(dna), > 3): > codon = dna[i:i+3] > # if codon == 'ATG': > # print(str(i)) > print(codon, i) > # why do you need str(i)? > print(codon, str(i)) # - nothing i ...
written 11 months ago by natasha.sernova3.7k • updated 11 months ago by Joe18k

Latest awards to natasha.sernova

Prophet 12 days ago, created a post with more than 20 followers. For how to convert a long fasta-file into many separate single fasta sequences
Great Question 9 months ago, created a question with more than 5,000 views. For an equivalent python statement for perl's "next"-statement
Popular Question 10 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 12 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 12 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 12 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 13 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 14 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 17 months ago, created a question with more than 1,000 views. For Prokaryotic nucleotide (gi-number OR ID) database
Popular Question 17 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 17 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 18 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 18 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 19 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Great Question 19 months ago, created a question with more than 5,000 views. For GATK: vcf to fasta
Appreciated 20 months ago, created a post with more than 5 votes. For how to convert a long fasta-file into many separate single fasta sequences
Teacher 20 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Autobiographer 22 months ago, has more than 80 characters in the information field of the user's profile.
Popular Question 23 months ago, created a question with more than 1,000 views. For Tools to find the unique proteins (without orthologs) in a bacterial taxon
Popular Question 23 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 2.1 years ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Scholar 2.1 years ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Scholar 2.1 years ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 948 users visited in the last hour