User: natasha.sernova

gravatar for natasha.sernova
natasha.sernova3.7k
Reputation:
3,700
Status:
Trusted
Location:
Last seen:
an hour ago
Joined:
6 years, 4 months ago
Email:
n**************@gmail.com

Posts by natasha.sernova

<prev • 859 results • page 1 of 86 • next >
0
votes
0
answers
97
views
0
answers
Comment: C: Maf to Fasta
... The following post may be helpful: https://www.biostars.org/p/386058/ Look at the right panel after you have submitted your question. You will see a lot of similar questions! ...
written 5 weeks ago by natasha.sernova3.7k
0
votes
1
answer
115
views
1
answers
Comment: A: GENCODE and untranslated regions
... This post looks helpful. https://www.biostars.org/p/48502/ ...
written 10 weeks ago by natasha.sernova3.7k
0
votes
2
answers
187
views
2
answers
Comment: C: Which gene name should I choose?
... See these posts, they may help you. The second post shows that it's not an easy question at all. Good luck! https://www.biostars.org/p/164321/ https://www.biostars.org/p/1378/ https://www.biostars.org/p/319781/ Sometimes gene name depends upon species, approach or database. https://www.biostar ...
written 12 weeks ago by natasha.sernova3.7k
2
votes
0
answers
166
views
0
answers
Comment: C: Update list of asseccion numbers
... There are a few posts about update of accession numbers in Biostar database, I found some, but you may continue the search if it's not enough to you. Go to the upper left corner of the page, press 'LATEST' and type your question: 'update of accession number'. In case there is no answer, replac ...
written 12 weeks ago by natasha.sernova3.7k
7
votes
2
answers
227
views
2
answers
Forum: How to follow a particular post on Biostars?
... Dear all! Sorry, it's a trivial question. If I like some particular post, what should I do to follow it? So far I've saved its link in a file, but is there a better way? I found just a post about following a particular post-author with many nice posts. I would like to follow a single post. How s ...
post following forum written 3 months ago by natasha.sernova3.7k • updated 19 days ago by andrewjacob4280
0
votes
2
answers
197
views
2
answers
Comment: C: Python- Searching codons using for/if
... > dna = "ATGCGATCGATCGATCGATCGCGCGCGCAGCTA" for i in range(0, len(dna), > 3): > codon = dna[i:i+3] > # if codon == 'ATG': > # print(str(i)) > print(codon, i) > # why do you need str(i)? > print(codon, str(i)) # - nothing i ...
written 3 months ago by natasha.sernova3.7k • updated 3 months ago by Joe16k
0
votes
0
answers
164
views
0
answers
Comment: C: How to extract hypervariable region of mitochondrial dna from its fasta file?
... There are several hypervariable regions in mtDNA, I know about at least two of them. There is a kit to extract them https://norgenbiotek.com/sites/default/files/resources/Mitochondrial-DNA-Hypervariable-Region-I-and%20II-Insert-PI52800-1.pdf See this article, it may help you. mtDNA Variation and ...
written 3 months ago by natasha.sernova3.7k
0
votes
2
answers
191
views
2
answers
Comment: C: Examples of structure-based functional comparison of enzyme active centers
... Many thanks, it's a nice group. Since active site is labelled, it's one more chance. https://www.biostars.org/p/97158/ ...
written 3 months ago by natasha.sernova3.7k
0
votes
2
answers
191
views
2
answers
Comment: C: Examples of structure-based functional comparison of enzyme active centers
... Thank you very much, but I don't have any free choice. I have to use PyMol. I'll try Chimera next time. ...
written 3 months ago by natasha.sernova3.7k
0
votes
2
answers
191
views
2
answers
Comment: C: Examples of structure-based functional comparison of enzyme active centers
... Dear Professor Dlakic, thank you very much indeed for your answer! By the way, do you like PYMOL? There are so many other tools now like CHIMERA, etc, but my colleagues make me use PYMOL to solve this problem, at least, to make pictures. I'll check your links tomorrow. Thousand thanks for your sug ...
written 3 months ago by natasha.sernova3.7k

Latest awards to natasha.sernova

Great Question 28 days ago, created a question with more than 5,000 views. For an equivalent python statement for perl's "next"-statement
Popular Question 9 weeks ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 3 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 3 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 4 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 5 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 8 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 8 months ago, created a question with more than 1,000 views. For Prokaryotic nucleotide (gi-number OR ID) database
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 9 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 9 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 10 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 11 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Great Question 11 months ago, created a question with more than 5,000 views. For GATK: vcf to fasta
Appreciated 11 months ago, created a post with more than 5 votes. For how to convert a long fasta-file into many separate single fasta sequences
Teacher 12 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Autobiographer 13 months ago, has more than 80 characters in the information field of the user's profile.
Popular Question 15 months ago, created a question with more than 1,000 views. For Tools to find the unique proteins (without orthologs) in a bacterial taxon
Popular Question 15 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 16 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Scholar 17 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1765 users visited in the last hour