User: natasha.sernova

gravatar for natasha.sernova
natasha.sernova3.7k
Reputation:
3,700
Status:
Trusted
Location:
Last seen:
2 days, 18 hours ago
Joined:
6 years, 9 months ago
Email:
n**************@gmail.com

Posts by natasha.sernova

<prev • 863 results • page 1 of 87 • next >
0
votes
1
answer
137
views
1
answers
Comment: C: The SARS-CoV-2 genome alignment option
... Unfortunately some genomes are elsewhere, I had to search other dbs to find most of them. ...
written 9 weeks ago by natasha.sernova3.7k
2
votes
1
answer
137
views
1
answer
The SARS-CoV-2 genome alignment option
... Dear all, Nowadays many scientists have to solve some problems related to SARS-CoV-2. The viral genomes are huge(~30kb). Is it correct, that to align several of them I have to put those fasta-genomes to a single file, add a reference genome to the same file and run a proper tool like MAFFT? (lik ...
mafft mafft-l-ins-i sars-cov-2 written 9 weeks ago by natasha.sernova3.7k
0
votes
2
answers
1.1k
views
2
answers
Comment: A: Predicting the 3D structure of a protein
... According to this page: https://blanco.biomol.uci.edu/mpex/ it may be used. ...
written 3 months ago by natasha.sernova3.7k
0
votes
0
answers
268
views
0
answers
Comment: C: designing PCR for COVID19
... IMHO it is an important topic. Any country has at least a few patients now. And very few articles discuss experimental procedures and provide some details. Where else is it possible to find some current scientific information, if not here? Thank you! ...
written 4 months ago by natasha.sernova3.7k
0
votes
0
answers
272
views
0
answers
Comment: C: Maf to Fasta
... The following post may be helpful: https://www.biostars.org/p/386058/ Look at the right panel after you have submitted your question. You will see a lot of similar questions! ...
written 6 months ago by natasha.sernova3.7k
0
votes
1
answer
186
views
1
answers
Comment: A: GENCODE and untranslated regions
... This post looks helpful. https://www.biostars.org/p/48502/ ...
written 7 months ago by natasha.sernova3.7k
0
votes
2
answers
248
views
2
answers
Comment: C: Which gene name should I choose?
... See these posts, they may help you. The second post shows that it's not an easy question at all. Good luck! https://www.biostars.org/p/164321/ https://www.biostars.org/p/1378/ https://www.biostars.org/p/319781/ Sometimes gene name depends upon species, approach or database. https://www.biostar ...
written 7 months ago by natasha.sernova3.7k
2
votes
0
answers
222
views
0
answers
Comment: C: Update list of asseccion numbers
... There are a few posts about update of accession numbers in Biostar database, I found some, but you may continue the search if it's not enough to you. Go to the upper left corner of the page, press 'LATEST' and type your question: 'update of accession number'. In case there is no answer, replac ...
written 7 months ago by natasha.sernova3.7k
7
votes
2
answers
299
views
2
answers
Forum: How to follow a particular post on Biostars?
... Dear all! Sorry, it's a trivial question. If I like some particular post, what should I do to follow it? So far I've saved its link in a file, but is there a better way? I found just a post about following a particular post-author with many nice posts. I would like to follow a single post. How s ...
post following forum written 7 months ago by natasha.sernova3.7k • updated 5 months ago by andrewjacob4280
0
votes
2
answers
601
views
2
answers
Comment: C: Python- Searching codons using for/if
... > dna = "ATGCGATCGATCGATCGATCGCGCGCGCAGCTA" for i in range(0, len(dna), > 3): > codon = dna[i:i+3] > # if codon == 'ATG': > # print(str(i)) > print(codon, i) > # why do you need str(i)? > print(codon, str(i)) # - nothing i ...
written 8 months ago by natasha.sernova3.7k • updated 8 months ago by Joe17k

Latest awards to natasha.sernova

Great Question 5 months ago, created a question with more than 5,000 views. For an equivalent python statement for perl's "next"-statement
Popular Question 7 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 8 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 8 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 9 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 10 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 13 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 13 months ago, created a question with more than 1,000 views. For Prokaryotic nucleotide (gi-number OR ID) database
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 14 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 14 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 15 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 16 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Great Question 16 months ago, created a question with more than 5,000 views. For GATK: vcf to fasta
Appreciated 16 months ago, created a post with more than 5 votes. For how to convert a long fasta-file into many separate single fasta sequences
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Autobiographer 18 months ago, has more than 80 characters in the information field of the user's profile.
Popular Question 20 months ago, created a question with more than 1,000 views. For Tools to find the unique proteins (without orthologs) in a bacterial taxon
Popular Question 20 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 21 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Teacher 21 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Teacher 22 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Scholar 22 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1487 users visited in the last hour