User: natasha.sernova

gravatar for natasha.sernova
natasha.sernova3.6k
Reputation:
3,640
Status:
Trusted
Location:
Last seen:
23 hours ago
Joined:
6 years, 1 month ago
Email:
n**************@gmail.com

Posts by natasha.sernova

<prev • 854 results • page 1 of 86 • next >
0
votes
2
answers
71
views
2
answers
Comment: C: Python- Searching codons using for/if
... > dna = "ATGCGATCGATCGATCGATCGCGCGCGCAGCTA" for i in range(0, len(dna), > 3): > codon = dna[i:i+3] > # if codon == 'ATG': > # print(str(i)) > print(codon, i) > # why do you need str(i)? > print(codon, str(i)) # - nothing i ...
written 1 day ago by natasha.sernova3.6k • updated 1 day ago by Joe15k
0
votes
0
answers
97
views
0
answers
Comment: C: How to extract hypervariable region of mitochondrial dna from its fasta file?
... There are several hypervariable regions in mtDNA, I know about at least two of them. There is a kit to extract them https://norgenbiotek.com/sites/default/files/resources/Mitochondrial-DNA-Hypervariable-Region-I-and%20II-Insert-PI52800-1.pdf See this article, it may help you. mtDNA Variation and ...
written 3 days ago by natasha.sernova3.6k
0
votes
2
answers
127
views
2
answers
Comment: C: Examples of structure-based functional comparison of enzyme active centers
... Many thanks, it's a nice group. Since active site is labelled, it's one more chance. https://www.biostars.org/p/97158/ ...
written 16 days ago by natasha.sernova3.6k
0
votes
2
answers
127
views
2
answers
Comment: C: Examples of structure-based functional comparison of enzyme active centers
... Thank you very much, but I don't have any free choice. I have to use PyMol. I'll try Chimera next time. ...
written 16 days ago by natasha.sernova3.6k
0
votes
2
answers
127
views
2
answers
Comment: C: Examples of structure-based functional comparison of enzyme active centers
... Dear Professor Dlakic, thank you very much indeed for your answer! By the way, do you like PYMOL? There are so many other tools now like CHIMERA, etc, but my colleagues make me use PYMOL to solve this problem, at least, to make pictures. I'll check your links tomorrow. Thousand thanks for your sug ...
written 16 days ago by natasha.sernova3.6k
6
votes
2
answers
127
views
5 follow
2
answers
Examples of structure-based functional comparison of enzyme active centers
... Dear all, I’m trying to compare 4 orthologous proteins-enzymes and the corresponding pdb-files for them. Species are rather far from each other, so the sequences are far from identity. Never the less their functions look close – I hope at least their active centers have high structural identity, i ...
protein structure functional comparison written 17 days ago by natasha.sernova3.6k • updated 16 days ago by Joe15k
2
votes
1
answer
96
views
1
answers
Answer: A: protein pathway analysis software or tools
... See this article: A Review of Pathway-Based Analysis Tools That Visualize Genetic Variants Elisa Cirillo,1,* Laurence D. Parnell,2 and Chris T. Evelo1 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5681904/ Below is a fragment of the article abstract: "Pathway analysis is a powerful method for da ...
written 18 days ago by natasha.sernova3.6k
0
votes
0
answers
118
views
0
answers
Comment: C: which positions of upstream or downstream sequences would be considered for moti
... In mouse (and human) RNA-regulation is preferred. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6249886/ “With the advent of transcriptomic studies, it was revealed that only 2% of the genome has protein-coding capacity [1, 2], and the vast majority of transcripts that do not have protein coding c ...
written 25 days ago by natasha.sernova3.6k
0
votes
1
answer
102
views
1
answers
Answer: C: Database about antigens, used in tumor vaccination?
... See the following recent article, it enumerates a lot of such databases. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5856276/ In silico prediction of cancer immunogens: current state of the art Irini A. Doytchinova1 and Darren R. Flower See also this article, it looks close to your question. h ...
written 4 weeks ago by natasha.sernova3.6k
0
votes
0
answers
114
views
0
answers
Comment: A: Draw lines connecting pair of atoms in PyMOL
... Search this site https://sourceforge.net/p/pymol/mailman/message/28460905/ and finally you will find the following post: From: Thomas Holder - 2011-11-28 14:35:14 <> most trivial manner: as cartoon show sticks, resn LEU+ILE+VAL set cartoon_side_chain_helper and eventually something like ...
written 4 weeks ago by natasha.sernova3.6k

Latest awards to natasha.sernova

Scholar 17 days ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 22 days ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 23 days ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 7 weeks ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Scholar 11 weeks ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 5 months ago, created a question with more than 1,000 views. For Prokaryotic nucleotide (gi-number OR ID) database
Popular Question 5 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Popular Question 6 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 6 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 7 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 8 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Great Question 8 months ago, created a question with more than 5,000 views. For GATK: vcf to fasta
Appreciated 8 months ago, created a post with more than 5 votes. For how to convert a long fasta-file into many separate single fasta sequences
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Autobiographer 10 months ago, has more than 80 characters in the information field of the user's profile.
Popular Question 12 months ago, created a question with more than 1,000 views. For How To Split Hhm_Db Into Hhm-Files?
Popular Question 12 months ago, created a question with more than 1,000 views. For Tools to find the unique proteins (without orthologs) in a bacterial taxon
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Scholar 13 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Scholar 14 months ago, created an answer that has been accepted. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: where can I get environmental bacteria genome in fasta format (as many as possib
Teacher 15 months ago, created an answer with at least 3 up-votes. For A: dN/dS ratio (omega)
Popular Question 15 months ago, created a question with more than 1,000 views. For Tools to find the unique proteins (without orthologs) in a bacterial taxon

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2346 users visited in the last hour