User: Biogeek

gravatar for Biogeek
Biogeek400
Reputation:
400
Status:
Trusted
Location:
Last seen:
1 month ago
Joined:
7 years, 1 month ago
Email:
p**********@gmail.com

about me

Posts by Biogeek

<prev • 189 results • page 1 of 19 • next >
0
votes
0
answers
107
views
0
answers
Comment: C: Appending sequences to downloaded NCBI nt database
... Also tried $ blastdb_aliastool -dblist_file dblistfile -dbtype nucl -title "ntandalh" -out ntandalh Still failing with error message: > BLAST Database error: BLASTDB alias file creation failed. Some referenced files may be missing ...
written 6 weeks ago by Biogeek400
0
votes
0
answers
107
views
0
answers
Comment: C: Appending sequences to downloaded NCBI nt database
... I've worked out I can generate .nhd and .nhi by using the additional option '-hash_index'. Still need to generate .nnd and .nni. ...
written 6 weeks ago by Biogeek400
0
votes
0
answers
107
views
0
answers
Appending sequences to downloaded NCBI nt database
... I have an issue. I already have the entire ncbi nt database downloaded which I perform my nulceotide searches on. I am wishing to add sequences from a .fasta file. My file format is as follows: >Allobacillus_halotolerans GTAATCCGTGAAAGAGAAATCGGCGTTAATTAATTGACAATTGAGAGGAGGTCAACCTCAAAT ...
ncbi makeblastdb blastdb_alias written 6 weeks ago by Biogeek400
1
vote
2
answers
171
views
2
answers
Answer: A: Renaming Entry In Fasta File
... `sed 's/NODE/lclav_contig/' {INPUT FILE} | sed 's/_/ /g' | sed 's/ /_/1' > {OUTPUT FILE}` *Apologies, should have replied inline. ...
written 6 months ago by Biogeek400
0
votes
1
answer
130
views
1
answers
Comment: C: Retrieve multiple refseq genomes in seperate fasta files
... Good call genomax, thanks! I've now installed the Entrez utilities and can obtain my record with efetch. I'll write a loop using the 'list.txt' file I have which contains accession numbers. One more question, apologies for the ignorance (as required), is there a way I can also obtain my .fasta file ...
written 6 months ago by Biogeek400
1
vote
1
answer
130
views
1
answer
Retrieve multiple refseq genomes in seperate fasta files
... I've had a search and I can't seem to find any relatable questions. My task is as follows: 1. I have a list of Refseq accessions in a .txt file. 2. I want to download all the associated genomes to seperate .fasta files in a local directory. I note that I can use Entrez or NCBI assembly downloa ...
ncbi genome download refseq written 7 months ago by Biogeek400
0
votes
0
answers
362
views
0
answers
Bioinformatics workstation Spec advice: Metagenomics
... Hey fellow Biostars, I'm tasked with buying a workstation for my research group (metagenomics) and would like some advice/pointers. I know this question has been asked several times before; however, given that tech advances each year, I thought it would be appropriate to ask it again in 2020. A wor ...
metagenomics ram workstation written 8 months ago by Biogeek400
0
votes
4
answers
717
views
4
answers
Comment: C: General question about batch effect, read trimming and what to do when the adapt
... Mozart, the paired files are what you use. I just want to confirm with you though...Are they the correct Adaptor sequences that your sequencing was performed with? It may be that the adaptor sequences were removed by the facility, common. As such, very low % of reads will be trimmed.. [Link to Next ...
written 20 months ago by Biogeek400
0
votes
1
answer
360
views
1
answers
Comment: C: gene IDs enrichment in plants
... What sort of data do you want to carry out an enrichment on? Also what plant are you working with, is it a model or a non-model? ...
written 21 months ago by Biogeek400
1
vote
4
answers
717
views
4
answers
Answer: A: General question about batch effect, read trimming and what to do when the adapt
... I'd recommend using BBDUK under the bb tools suite by Brian Bushnell. It has an extensive adapter.fa file containing all publicly available adaptor sequences - just an idea? The amount of times people sue Trimmomatic without the correct adaptor sequence .fa file. Admittedly I also made that mistake ...
written 21 months ago by Biogeek400

Latest awards to Biogeek

Popular Question 6 months ago, created a question with more than 1,000 views. For Annotating the transcripts of a de novo plant transcriptome
Great Question 6 months ago, created a question with more than 5,000 views. For MDS plots with R
Popular Question 6 months ago, created a question with more than 1,000 views. For Low number of differentially expressed genes
Popular Question 6 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Popular Question 6 months ago, created a question with more than 1,000 views. For Parsing uniprot .dat files
Popular Question 6 months ago, created a question with more than 1,000 views. For edgeR: is calcnormfactors necessary for complex GLM approach?
Popular Question 6 months ago, created a question with more than 1,000 views. For Stand alone Blast annotation with multiple databases
Popular Question 8 months ago, created a question with more than 1,000 views. For Any tools out there for Interproscan enrichment analysis?
Popular Question 13 months ago, created a question with more than 1,000 views. For Any tools out there for Interproscan enrichment analysis?
Popular Question 13 months ago, created a question with more than 1,000 views. For Low number of differentially expressed genes
Popular Question 13 months ago, created a question with more than 1,000 views. For edgeR: is calcnormfactors necessary for complex GLM approach?
Popular Question 13 months ago, created a question with more than 1,000 views. For Annotation: From GO to IPS
Popular Question 13 months ago, created a question with more than 1,000 views. For curating a viridiplantae database
Popular Question 14 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Great Question 20 months ago, created a question with more than 5,000 views. For Paired End Trimmomatic producing asymmetric paired read files.
Great Question 20 months ago, created a question with more than 5,000 views. For MDS plots with R
Popular Question 20 months ago, created a question with more than 1,000 views. For curating a viridiplantae database
Popular Question 20 months ago, created a question with more than 1,000 views. For EdgeR filter thresholds
Popular Question 20 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Popular Question 21 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Popular Question 22 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Popular Question 22 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Popular Question 23 months ago, created a question with more than 1,000 views. For RNA-Seq of environmental samples
Popular Question 2.0 years ago, created a question with more than 1,000 views. For EdgeR filter thresholds
Popular Question 2.1 years ago, created a question with more than 1,000 views. For EdgeR filter thresholds

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2109 users visited in the last hour
_