Removing Adaptor From Illumina Pair-End Sequencing Data
1
0
Entering edit mode
12.3 years ago
Plantae ▴ 390

I am confused about how to remove adaptor sequences from sequence reads during data preprocessing stage,
according to a post from seqanswer.com, PE adapters and primers are: PE Adapter1:

5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'

PE Adapter2:

5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

PE PCR Primer1:

5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3' 3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'

PE PCR Primer2:

5' -------------------- -------------------- ------------------ (-)-------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'

but, which sequence should i use?
currently, i use:

ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT
GATCGGAAGAGCGGTTCAG CAGGAATGCCGAG

as the adaptor sequence.

next-gen adaptor • 3.9k views
ADD COMMENT
3
Entering edit mode
12.3 years ago

[?]Illumina library adapter/primer sequences[?]

ADD COMMENT

Login before adding your answer.

Traffic: 2807 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6