Question: Removing Adaptor From Illumina Pair-End Sequencing Data
gravatar for Plantae
8.8 years ago by
Plantae380 wrote:

I am confused about how to remove adaptor sequences from sequence reads during data preprocessing stage,
according to a post from, PE adapters and primers are: PE Adapter1:

5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'

PE Adapter2:

5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

PE PCR Primer1:

5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3' 3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'

PE PCR Primer2:

5' -------------------- -------------------- ------------------ (-)-------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'

but, which sequence should i use?
currently, i use:


as the adaptor sequence.

next-gen adaptor • 3.2k views
ADD COMMENTlink modified 8.8 years ago by Damian Kao15k • written 8.8 years ago by Plantae380
gravatar for Damian Kao
8.8 years ago by
Damian Kao15k
Damian Kao15k wrote:

[?]Illumina library adapter/primer sequences[?]

ADD COMMENTlink written 8.8 years ago by Damian Kao15k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1217 users visited in the last hour