Question: Small Rna Sequencing Primer
0
gravatar for Sara
2.3 years ago by
Sara60
Sara60 wrote:

Hi,

could you please tell me where i can find the adaptor sequence of illumina small RNA (miRNA) kit? is it universal, I means the sequence is changing from one sequencer to another or it is the same sequence for all type of sequencer?

for trimming, Should i trim 3' adapter or 5' too?

Thanks in advance for reply Sara

ADD COMMENTlink written 2.3 years ago by Sara60
2
gravatar for Steve Lianoglou
2.3 years ago by
Steve Lianoglou3.7k
US
Steve Lianoglou3.7k wrote:

FastQC has a list of "contaminants" that it matches against when looking for over represented sequences in your sequencing file.

The sequences listed there are parts (or all) of many of the sequencing adapters used in different library preps. I'll paste that in for you below ... you'll see there are some from an Illumina "Small Rna" prep, so perhaps those are the ones you are looking for, but if this is your data, your best bet is to obviously talk to the person who is making the libraries. If you are using data from a publication, they should cite what prep they used (or describe their own in their supplemental methods) where you can likely get the information you are after.

Also -- I'd bet you should be looking at the 3' ends of the reads to locate and strip your adapters from.

Illumina Single End Adapter 1                    ACACTCTTTCCCTACACGACGCTGTTCCATCT
Illumina Single End Adapter 2                    CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Illumina Single End PCR Primer 1                AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Single End PCR Primer 2                CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Illumina Single End Sequencing Primer            ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Illumina Paired End Adapter 1                    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Paired End Adapter 2                    CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
Illumina Paried End PCR Primer 1                AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Paired End PCR Primer 2                CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
Illumina Paried End Sequencing Primer 1            ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Paired End Sequencing Primer 2            CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT

Illumina DpnII expression Adapter 1                ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII expression Adapter 2                CAAGCAGAAGACGGCATACGA
Illumina DpnII expression PCR Primer 1            CAAGCAGAAGACGGCATACGA
Illumina DpnII expression PCR Primer 2            AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Illumina DpnII expression Sequencing Primer        CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina NlaIII expression Adapter 1            ACAGGTTCAGAGTTCTACAGTCCGACATG
Illumina NlaIII expression Adapter 2            CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression PCR Primer 1            CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression PCR Primer 2            AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Illumina NlaIII expression Sequencing Primer    CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Illumina Small RNA Adapter 1                    GTTCAGAGTTCTACAGTCCGACGATC
Illumina Small RNA Adapter 2                    TCGTATGCCGTCTTCTGCTTGT
Illumina Small RNA RT Primer                    CAAGCAGAAGACGGCATACGA
Illumina Small RNA PCR Primer 1                    CAAGCAGAAGACGGCATACGA
Illumina Small RNA PCR Primer 2                    AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Illumina Small RNA Sequencing Primer            CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina Multiplexing Adapter 1                    GATCGGAAGAGCACACGTCT
Illumina Multiplexing Adapter 2                    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing PCR Primer 1.01            AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing PCR Primer 2.01            GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Illumina Multiplexing Read1 Sequencing Primer    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing Index Sequencing Primer    GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Illumina Multiplexing Read2 Sequencing Primer    GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

Illumina PCR Primer Index 1                        CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC
Illumina PCR Primer Index 2                        CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC
Illumina PCR Primer Index 3                        CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTC
Illumina PCR Primer Index 4                        CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTC
Illumina PCR Primer Index 5                        CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTC
Illumina PCR Primer Index 6                        CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTC
Illumina PCR Primer Index 7                        CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTC
Illumina PCR Primer Index 8                        CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTC
Illumina PCR Primer Index 9                        CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTC
Illumina PCR Primer Index 10                    CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTC
Illumina PCR Primer Index 11                    CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTC
Illumina PCR Primer Index 12                    CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC

Illumina DpnII Gex Adapter 1                    GATCGTCGGACTGTAGAACTCTGAAC
Illumina DpnII Gex Adapter 1.01                    ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII Gex Adapter 2                    CAAGCAGAAGACGGCATACGA
Illumina DpnII Gex Adapter 2.01                    TCGTATGCCGTCTTCTGCTTG
Illumina DpnII Gex PCR Primer 1                    CAAGCAGAAGACGGCATACGA
Illumina DpnII Gex PCR Primer 2                    AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Illumina DpnII Gex Sequencing Primer            CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina NlaIII Gex Adapter 1.01                TCGGACTGTAGAACTCTGAAC
Illumina NlaIII Gex Adapter 1.02                ACAGGTTCAGAGTTCTACAGTCCGACATG
Illumina NlaIII Gex Adapter 2.01                CAAGCAGAAGACGGCATACGA
Illumina NlaIII Gex Adapter 2.02                TCGTATGCCGTCTTCTGCTTG
Illumina NlaIII Gex PCR Primer 1                CAAGCAGAAGACGGCATACGA
Illumina NlaIII Gex PCR Primer 2                AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Illumina NlaIII Gex Sequencing Primer            CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Illumina Small RNA RT Primer                    CAAGCAGAAGACGGCATACGA
Illumina 5p RNA Adapter                            GTTCAGAGTTCTACAGTCCGACGATC
Illumina RNA Adapter1                            TCGTATGCCGTCTTCTGCTTGT

Illumina Small RNA 3p Adapter 1                    ATCTCGTATGCCGTCTTCTGCTTG
Illumina Small RNA PCR Primer 1                    CAAGCAGAAGACGGCATACGA
Illumina Small RNA PCR Primer 2                    AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Illumina Small RNA Sequencing Primer            CGACAGGTTCAGAGTTCTACAGTCCGACGATC

TruSeq Universal Adapter                        AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 4                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 5                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 6                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 7                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 8                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 9                            GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 10                        GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 11                        GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 12                        GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG

Illumina RNA RT Primer                            GCCTTGGCACCCGAGAATTCCA
Illumina RNA PCR Primer                            AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA

RNA PCR Primer, Index 1                            CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 2                            CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 3                            CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 4                            CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 5                            CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 6                            CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 7                            CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 8                            CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 9                            CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 10                        CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 11                        CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 12                        CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 13                        CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 14                        CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 15                        CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 16                        CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 17                        CAAGCAGAAGACGGCATACGAGATCTCTACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 18                        CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 19                        CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 20                        CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 21                        CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 22                        CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 23                        CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 24                        CAAGCAGAAGACGGCATACGAGATGCTACCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 25                        CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 26                        CAAGCAGAAGACGGCATACGAGATGCTCATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 27                        CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 28                        CAAGCAGAAGACGGCATACGAGATCTTTTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 29                        CAAGCAGAAGACGGCATACGAGATTAGTTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 30                        CAAGCAGAAGACGGCATACGAGATCCGGTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 31                        CAAGCAGAAGACGGCATACGAGATATCGTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 32                        CAAGCAGAAGACGGCATACGAGATTGAGTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 33                        CAAGCAGAAGACGGCATACGAGATCGCCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 34                        CAAGCAGAAGACGGCATACGAGATGCCATGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 35                        CAAGCAGAAGACGGCATACGAGATAAAATGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 36                        CAAGCAGAAGACGGCATACGAGATTGTTGGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 37                        CAAGCAGAAGACGGCATACGAGATATTCCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 38                        CAAGCAGAAGACGGCATACGAGATAGCTAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 39                        CAAGCAGAAGACGGCATACGAGATGTATAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 40                        CAAGCAGAAGACGGCATACGAGATTCTGAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 41                        CAAGCAGAAGACGGCATACGAGATGTCGTCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 42                        CAAGCAGAAGACGGCATACGAGATCGATTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 43                        CAAGCAGAAGACGGCATACGAGATGCTGTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 44                        CAAGCAGAAGACGGCATACGAGATATTATAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 45                        CAAGCAGAAGACGGCATACGAGATGAATGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 46                        CAAGCAGAAGACGGCATACGAGATTCGGGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 47                        CAAGCAGAAGACGGCATACGAGATCTTCGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 48                        CAAGCAGAAGACGGCATACGAGATTGCCGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA

ABI Dynabead EcoP Oligo                            CTGATCTAGAGGTACCGGATCCCAGCAGT
ABI Solid3 Adapter A                            CTGCCCCGGGTTCCTCATTCTCTCAGCAGCATG
ABI Solid3 Adapter B                            CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT
ABI Solid3 5' AMP Primer                        CCACTACGCCTCCGCTTTCCTCTCTATG
ABI Solid3 3' AMP Primer                        CTGCCCCGGGTTCCTCATTCT
ABI Solid3 EF1 alpha Sense Primer                CATGTGTGTTGAGAGCTTC
ABI Solid3 EF1 alpha Antisense Primer            GAAAACCAAAGTGGTCCAC
ABI Solid3 GAPDH Forward Primer                    TTAGCACCCCTGGCCAAGG
ABI Solid3 GAPDH Reverse Primer                    CTTACTCCTTGGAGGCCATG
ADD COMMENTlink written 2.3 years ago by Steve Lianoglou3.7k
Please log in to add an answer.

Help
Access
  • RSS
  • Stats
  • API

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.0.0
Traffic: 881 users visited in the last hour