Question: Small Rna Sequencing Primer
gravatar for Sara
6.3 years ago by
Sara60 wrote:


could you please tell me where i can find the adaptor sequence of illumina small RNA (miRNA) kit? is it universal, I means the sequence is changing from one sequencer to another or it is the same sequence for all type of sequencer?

for trimming, Should i trim 3' adapter or 5' too?

Thanks in advance for reply Sara

sequence adaptor mirna • 13k views
ADD COMMENTlink written 6.3 years ago by Sara60
gravatar for Steve Lianoglou
6.3 years ago by
Steve Lianoglou4.9k
Steve Lianoglou4.9k wrote:

FastQC has a list of "contaminants" that it matches against when looking for over represented sequences in your sequencing file.

The sequences listed there are parts (or all) of many of the sequencing adapters used in different library preps. I'll paste that in for you below ... you'll see there are some from an Illumina "Small Rna" prep, so perhaps those are the ones you are looking for, but if this is your data, your best bet is to obviously talk to the person who is making the libraries. If you are using data from a publication, they should cite what prep they used (or describe their own in their supplemental methods) where you can likely get the information you are after.

Also -- I'd bet you should be looking at the 3' ends of the reads to locate and strip your adapters from.

Illumina Single End Adapter 1                    ACACTCTTTCCCTACACGACGCTGTTCCATCT
Illumina Single End Adapter 2                    CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Illumina Single End PCR Primer 2                CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Illumina Single End Sequencing Primer            ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Illumina Paired End Adapter 1                    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Paired End Adapter 2                    CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
Illumina Paried End Sequencing Primer 1            ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Paired End Sequencing Primer 2            CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT

Illumina DpnII expression Adapter 1                ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII expression Adapter 2                CAAGCAGAAGACGGCATACGA
Illumina DpnII expression PCR Primer 1            CAAGCAGAAGACGGCATACGA
Illumina DpnII expression Sequencing Primer        CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina NlaIII expression Adapter 1            ACAGGTTCAGAGTTCTACAGTCCGACATG
Illumina NlaIII expression Adapter 2            CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression PCR Primer 1            CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression Sequencing Primer    CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Illumina Small RNA Adapter 1                    GTTCAGAGTTCTACAGTCCGACGATC
Illumina Small RNA Adapter 2                    TCGTATGCCGTCTTCTGCTTGT
Illumina Small RNA RT Primer                    CAAGCAGAAGACGGCATACGA
Illumina Small RNA PCR Primer 1                    CAAGCAGAAGACGGCATACGA
Illumina Small RNA Sequencing Primer            CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina Multiplexing Adapter 1                    GATCGGAAGAGCACACGTCT
Illumina Multiplexing Adapter 2                    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing PCR Primer 2.01            GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Illumina Multiplexing Read1 Sequencing Primer    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing Index Sequencing Primer    GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Illumina Multiplexing Read2 Sequencing Primer    GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT


Illumina DpnII Gex Adapter 1                    GATCGTCGGACTGTAGAACTCTGAAC
Illumina DpnII Gex Adapter 1.01                    ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII Gex Adapter 2                    CAAGCAGAAGACGGCATACGA
Illumina DpnII Gex Adapter 2.01                    TCGTATGCCGTCTTCTGCTTG
Illumina DpnII Gex PCR Primer 1                    CAAGCAGAAGACGGCATACGA
Illumina DpnII Gex Sequencing Primer            CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Illumina NlaIII Gex Adapter 1.01                TCGGACTGTAGAACTCTGAAC
Illumina NlaIII Gex Adapter 1.02                ACAGGTTCAGAGTTCTACAGTCCGACATG
Illumina NlaIII Gex Adapter 2.01                CAAGCAGAAGACGGCATACGA
Illumina NlaIII Gex Adapter 2.02                TCGTATGCCGTCTTCTGCTTG
Illumina NlaIII Gex PCR Primer 1                CAAGCAGAAGACGGCATACGA
Illumina NlaIII Gex Sequencing Primer            CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Illumina Small RNA RT Primer                    CAAGCAGAAGACGGCATACGA
Illumina 5p RNA Adapter                            GTTCAGAGTTCTACAGTCCGACGATC
Illumina RNA Adapter1                            TCGTATGCCGTCTTCTGCTTGT

Illumina Small RNA 3p Adapter 1                    ATCTCGTATGCCGTCTTCTGCTTG
Illumina Small RNA PCR Primer 1                    CAAGCAGAAGACGGCATACGA
Illumina Small RNA Sequencing Primer            CGACAGGTTCAGAGTTCTACAGTCCGACGATC


Illumina RNA RT Primer                            GCCTTGGCACCCGAGAATTCCA


ABI Dynabead EcoP Oligo                            CTGATCTAGAGGTACCGGATCCCAGCAGT
ABI Solid3 Adapter A                            CTGCCCCGGGTTCCTCATTCTCTCAGCAGCATG
ABI Solid3 5' AMP Primer                        CCACTACGCCTCCGCTTTCCTCTCTATG
ABI Solid3 3' AMP Primer                        CTGCCCCGGGTTCCTCATTCT
ABI Solid3 EF1 alpha Sense Primer                CATGTGTGTTGAGAGCTTC
ABI Solid3 EF1 alpha Antisense Primer            GAAAACCAAAGTGGTCCAC
ABI Solid3 GAPDH Forward Primer                    TTAGCACCCCTGGCCAAGG
ABI Solid3 GAPDH Reverse Primer                    CTTACTCCTTGGAGGCCATG
ADD COMMENTlink written 6.3 years ago by Steve Lianoglou4.9k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 631 users visited in the last hour