Entering edit mode
9.5 years ago
felipe.gtt
•
0
Hello,
I'm having a hard time to create a script to separe a RNA sequence in: stem1 - loop - stem2. I used RNAfold, to check how RNA's are represented but couldn't find a patter to finde the middle loop, is there a rule to find it?
Heres an example:
1 UUCUCGUCCCAGUUCUUCCCAAAGUUGAGAAAAGCUGGGUUGAGAGGA
1 ((((((.(((((((.(((.((....)).))).))))))).))))))..
I thought that the loop would simply be the middle (....) but it isn't, in this case, according to my research, the loop is:
CTTCCCAAAGTTGAGAAA
.(((.((....)).))).
in other cases the structure differs, so its pretty hard for me to finish my script.
sorry if its obvious but im simply not seeing it.
Thank you!
I'd say in that case your research and RNAfold disagree. Generally a minimal loop length of either 4 or 5 bases is accepted, so that might be helpful. Shorter stretches of unpaired bases would be "bubbles"