How to detect stem-loops from rna sequence

Question

[felipe.gtt]

Hello,

I'm having a hard time to create a script to separe a RNA sequence in: stem1 - loop - stem2. I used RNAfold, to check how RNA's are represented but couldn't find a patter to finde the middle loop, is there a rule to find it?

Heres an example:

1      UUCUCGUCCCAGUUCUUCCCAAAGUUGAGAAAAGCUGGGUUGAGAGGA

1      ((((((.(((((((.(((.((....)).))).))))))).))))))..

I thought that the loop would simply be the middle (....) but it isn't, in this case, according to my research, the loop is:

CTTCCCAAAGTTGAGAAA

.(((.((....)).))).

in other cases the structure differs, so its pretty hard for me to finish my script.

sorry if its obvious but im simply not seeing it.

Thank you!

[fanli.gcb]

I'd say in that case your research and RNAfold disagree. Generally a minimal loop length of either 4 or 5 bases is accepted, so that might be helpful. Shorter stretches of unpaired bases would be "bubbles"