Question: Does sgRNA have to be complementary to DNA strand?
gravatar for darkmatter1996
3.9 years ago by
darkmatter19960 wrote:

I have been analyzing the data from the Xu et. al (2015) paper (see Supplemental Table_1.xlsx here). However, it appears that many of the sgRNAs shown are not complementary to any part of the targeted gene indicated. For example, I downloaded the NCBI sequence data for the gene RPL17, and was not able to find the sgRNA strand TTTCTTCTGGGCAACCTCCTCTTCTGGTTTAGGAACAATC, which is inside the data set, complementary to anywhere inside the gene. I wrote the following python function for finding the position of the sgRNA in the gene, which returns -1 if no match is found:

def guide_positional_features(guide_seq, gene, strand):
    guide_seq = Seq.Seq(guide_seq)
    f = open("data/sequences/{}.txt".format(gene), "r")
    gene_seq =
    gene_seq = Seq.Seq(gene_seq).reverse_complement()
    if strand == '+': # sense strand
        guide_seq = guide_seq.reverse_complement()
    ind = gene_seq.find(guide_seq)

    return ind

Am I doing something wrong? Thanks.

sgrna python • 1.0k views
ADD COMMENTlink written 3.9 years ago by darkmatter19960
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1917 users visited in the last hour