paired reads (headers) show up in 3 lines of sam file instead of expected 2
Entering edit mode
4.8 years ago
raplayer ▴ 10


Try to count features of sam file:

htseq-count -m union -r name -t exon -i gene_id sorted1.mm10.sam mm10.gtf > sorted1.mm10.counts
100000 GFF lines processed.
200000 GFF lines processed.
300000 GFF lines processed.
400000 GFF lines processed.
500000 GFF lines processed.
600000 GFF lines processed.
690428 GFF lines processed.
Error occured when processing SAM input (line 108 of file sorted1.mm10.sam):
  'pair_alignments' needs a sequence of paired-end alignments
  [Exception type: ValueError, raised in]

check line 108 (compensating for header lines):

head -170 sorted1.mm10.sam | tail | awk '{print $1}'

So we see there are 3 alignments for "1609:93571"...

MONK:312:C2GR3ACXX:6:1101:1609:93571    401 chr5    87558545    60  40M61H  =   87555882    -2703   CCAGCTCTTCACATGATCATACCAGGGACCAAAGCTCACT    DDDCDCDDCCCDDEDD@DC@;DEECECBECFHEAA>E@GH    NM:i:0  MD:Z:40 AS:i:40 XS:i:19 SA:Z:chr5,87559761,-,38S63M,60,0;

check input fastq:

grep "1609:93571" sorted1.fastq 


What would cause a third alignment to be placed into a sam file from a pair of reads?

Is there a way to force only 1 alignment for each read (I thought I read in the manual this is the default)?

Is there a way to force htseq-count to ignore orphaned alignments like this?


bwa mem alignment sam • 1.4k views
Entering edit mode
4.8 years ago

The third alignment with a flag of 401 is not a primary alignment. This can mean different things depending on the aligner you used to generate the sam file. Some aligners will output multiple alignments and designate the best one as primary.

If you want to filter out all non-primary alignments you can:

samtools view -F 256 alignments.sam > filtered.sam

Login before adding your answer.

Traffic: 2551 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6