Question: Extract soft-clipped reads from BWA -generated SAM file
0
gravatar for ThePresident
2.1 years ago by
ThePresident100
ThePresident100 wrote:

Hi,

I aligned Illumina-generated, paired-end reads to reference sequence using bwa-mem. Now, I would like to extract soft-clipped reads in order to determine boundaries for some potential structural variants. I used samblaster tool with the following command:

bwa mem index R1.fastq R2.fastq | samblaster -u clipped.sam | samtools view -Sb - > clipped.bam | samtools sort - clipped_sorted.bam

However, I get a lot of supposedly soft clipped reads. I wasn't expecting a huge proportion of soft clipping to occur unless this is something common with bwa mem?

Here the output of my clipped SAM file:

    @D00780:28:HFJLLBCXX:1:1103:1175:2055_1
GCCATCTTTTCACTACTTGCTCCATATTTTTTGTCTGATTCGGTTGTGTTACTTGAAATGGCATTTGAGTAGTGAATACTTGGGTAGTCGATTCCTAGACCATTTAGGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTCCTGAGCA
+
DD@DDDHHIIIHIIEHHIIIHFHIIIIGHIIGHIIIIGHHHIHHIHHHHIIIIIFGHHIHHIIHHEIHHIIIIIIIIHGGIHIFHHDHIIHIHIIIIHIGIDGHHIHHHEHHIHHIGHHHHHIIIIIIIDDHHHHHIHIHHGHIIIHHFHC
@D00780:28:HFJLLBCXX:1:1103:1175:2055_2
ACGCGTAAGATCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCCATCTTTTCACTACTTGCTCCATATTTTTTGTCTGATTCGGTTGTGTTACTTGAAATGGCATTTGAGTAGTGAATACTTGGGTAGTCGATTCCTAGACCATTTAGG
+
.CHEHF@<D<GHGIIIIHIIIIIIHIHIIIIIHHGHHHHHHHHDEF@EC<IIHHDIHHIIIHHHHHHIIIIIIIIIHIIHHIHIIHIIIIGIIIIIIIHIIIIIIHIIIHGIHHIIIIIHHHIHIIIIIIHHIIHHEIHIIHGHHIDDDDD
@D00780:28:HFJLLBCXX:1:1103:1229:2156_1
soft-clipping • 1.5k views
ADD COMMENTlink modified 2.1 years ago by Biostar ♦♦ 20 • written 2.1 years ago by ThePresident100
2

That's the FASTQ, not SAM.

ADD REPLYlink written 2.1 years ago by Chris Fields1.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1794 users visited in the last hour