Question: Confusion over SNP strand importance re genotyping (G>C)
2
gravatar for oooner2014
4.1 years ago by
oooner201420
oooner201420 wrote:

Basically, an original paper looked at a C>G mutation on the forward strand, our Taqman is designed on the reverse strand for a G>C mutation. Does this mean that we have to invert our results to compare them to the original paper? i.e. We can't directly compare our GG results to their GG results?

I came across this answer (https://abcommunity.thermofisher.com/community/real-time_pcr/blog/2014/07/24/which-allele-is-detected-by-my-snp-assay-probes), which has only served to confuse me further... They're using rs3892097 (G>A) as an example. It's oriented on the reverse strand.

"For example, the C__27102431_D0 assay, which targets the CYP2D6*4 g.1846G>A SNP, rs3892097, has the following context sequence: AGACCGTTGGGGCGAAAGGGGCGTC[C/T]TGGGGGTGGGAGATGCGGGTAAGGG" So from this, I gather that they're saying as it's on the reverse strand - C is being read for G, and T for A? Which confuses me over my own question as to whether or not I need to reverse my results to compare like with like.

Any help clarifying this would be greatly appreciated!!

dna snp strand genotyping taqman • 1.3k views
ADD COMMENTlink modified 4.1 years ago • written 4.1 years ago by oooner201420
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1001 users visited in the last hour