Confusion over SNP strand importance re genotyping (G>C)
0
2
Entering edit mode
4.7 years ago
oooner2014 ▴ 20

Basically, an original paper looked at a C>G mutation on the forward strand, our Taqman is designed on the reverse strand for a G>C mutation. Does this mean that we have to invert our results to compare them to the original paper? i.e. We can't directly compare our GG results to their GG results?

I came across this answer (https://abcommunity.thermofisher.com/community/real-time_pcr/blog/2014/07/24/which-allele-is-detected-by-my-snp-assay-probes), which has only served to confuse me further... They're using rs3892097 (G>A) as an example. It's oriented on the reverse strand.

"For example, the C__27102431_D0 assay, which targets the CYP2D6*4 g.1846G>A SNP, rs3892097, has the following context sequence: AGACCGTTGGGGCGAAAGGGGCGTC[C/T]TGGGGGTGGGAGATGCGGGTAAGGG" So from this, I gather that they're saying as it's on the reverse strand - C is being read for G, and T for A? Which confuses me over my own question as to whether or not I need to reverse my results to compare like with like.

Any help clarifying this would be greatly appreciated!!

taqman genotyping strand dna SNP • 1.4k views
ADD COMMENT

Login before adding your answer.

Traffic: 2142 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6