Question: a5 assembly Error building contigs with IDBA
0
gravatar for kingcohn
3.7 years ago by
kingcohn20
kingcohn20 wrote:

I am using the a5 assembler to construct a de novo genome. The sample data ran without any issues but I'm getting an error with my fastq reads.

[a5] Found the following libraries:
     raw1:
      id=raw1
      p1=/home/molecularecology/Desktop/zcpb/raw_cp3/CPBWGS_three_1.fastq.gz
      p2=/home/molecularecology/Desktop/zcpb/raw_cp3/CPBWGS_three_2.fastq.gz
[a5] Found 1 libraries
[a5] Starting pipeline at step 1
[a5] Cleaning reads with SGA
[a5] Cleaning reads with SGA
cleaning each PE lib

p1 is a5CP3/CPBWGS_three_1.fastq.gz.a5unzipped
Cleaning reads

[a5] java -Xmx512m -jar '/home/molecularecology/Desktop/a5_miseq_linux_20160825/bin'/trimmomatic.jar SE -threads 4 -phred33  a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.both.fastq a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.trim.fastq ILLUMINACLIP:/home/molecularecology/Desktop/a5_miseq_linux_20160825/bin/../adapter.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticSE: Started with arguments: -threads 4 -phred33 a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.both.fastq a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.trim.fastq ILLUMINACLIP:/home/molecularecology/Desktop/a5_miseq_linux_20160825/bin/../adapter.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCTGATGGCGCGAGGGAGGC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGC'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'TTTTTTTTTTCAAGCAGAAGACGGCATACGA'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
ILLUMINACLIP: Using 3 prefix pairs, 16 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 96160254 Surviving: 93109717 (96.83%) Dropped: 3050537 (3.17%)
TrimmomaticSE: Completed successfully
[a5] '/home/molecularecology/Desktop/a5_miseq_linux_20160825/bin'/sga preprocess -q 25 -f 20 -m 35  --pe-mode=0  a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.trim.fastq > a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.both.pp 2> /dev/null
[a5] sga index -d 8210180 -t 4 a5CP3.s1/a5CP3.pp.fastq > a5CP3.s1/index.out 2> a5CP3.s1/index.err
[a5] '/home/molecularecology/Desktop/a5_miseq_linux_20160825/bin'/sga correct -t 4 -p a5CP3.pp -o a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.both.pp.ec.fastq a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.both.pp > a5CP3.s1/raw1.correct.out
[timer - sga::correct] wall clock: 13901.98s CPU: 53675.25s
Running cat a5CP3.s1/CPBWGS_three_1.fastq.gz.a5unzipped.both.repair.fastq >> a5CP3.s1/a5CP3.ec.fastq
Done merging libraries
[a5_s2] Building contigs from a5CP3.ec.fastq with IDBA
[a5_s2] Building contigs from a5CP3.ec.fastq with IDBA
[a5] a5CP3.s2/a5CP3.ec.fasta has 14936675647 bytes of FastA sequence data
[a5] '/home/molecularecology/Desktop/a5_miseq_linux_20160825/bin'/idba_ud500 --num_threads 4 -r a5CP3.s2/a5CP3.ec.fasta  -o a5CP3.s2/a5CP3 --mink 35 --maxk 125 --min_pairs 2 
Killed
[a5] Error building contigs with IDBA

thanks for your consideration!

ADD COMMENTlink modified 3.7 years ago • written 3.7 years ago by kingcohn20

I have these same errors with some of my many runs, and I wonder if you or anyone else has de-bugged the source of this error, and can share it here...

ADD REPLYlink written 2.7 years ago by Anand Rao290
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1863 users visited in the last hour