Question: How to carry out quality control using Trimmomatic on SRA reads of SAGE-RNASeq?
gravatar for hasche89
6 weeks ago by
hasche890 wrote:

I have carried out a FASTQC analysis on raw reads of SAGE-RNASeq experiment from SRA database. Numerous over-represented sequences have turned up pertaining to Illumina single end adapters and primers; paired end pcr primers, indexes etc (See black quotes).

Currently, I am confused about how to carry out the QC of these reads. Kindly help.

ATAATAAAGATTGCTCTCATCATAATCGTATGCCGTCTTCTGCTTG 73871 1.5328089718844269 Illumina Single End Adapter 2 (95% over 22bp) TAATAATTGGAACTTTACATCATAATCGTATGCCGTCTTCTGCTTG 45681 0.9478719205730599 Illumina Single End Adapter 1 (95% over 22bp) AAATATAATTTCTTCATCATCATAATCGTATGCCGTCTTCTGCTTG 42720 0.8864317428883149 Illumina Single End Adapter 2 (95% over 22bp) CTAATTGTGATATAAATCATCATAATCGTATGCCGTCTTCTGCTTG 35652 0.7397721090228044 Illumina Single End Adapter 1 (95% over 22bp) AGCACCAATAAATAACTCCATCATAATCGTATGCCGTCTTCTGCTT 27850 0.5778821170280799 Illumina Paired End PCR Primer 2 (95% over 21bp) TACCCCGGTATCGCCGACCATCATAATCGTATGCCGTCTTCTGCTT 27671 0.5741679016259963 Illumina Single End Adapter 1 (95% over 21bp) TTTACACGTGATGTAATCATCATAATCGTATGCCGTCTTCTGCTTG 27570 0.5720721711477258 Illumina Single End Adapter 1 (95% over 22bp) AGGTGATGCTAAACATCCATCATAATCGTATGCCGTCTTCTGCTTG 26864 0.5574228076065472 Illumina Single End Adapter 1 (95% over 22bp) ATGGCGAGTGTGTTTCTCATCATAATCGTATGCCGTCTTCTGCTTG 25399 0.5270243407682658 Illumina Single End Adapter 2 (95% over 22bp) GGCAGGTGATCTACACGCCATCATAATCGTATGCCGTCTTCTGCTT 22834 0.47380108654287884 Illumina Single End Adapter 1 (95% over 21bp) AGGTGATGCTAAACATCACATCATAATCGTATGCCGTCTTCTGCTT 22822 0.4735520888622923 Illumina Single End Adapter 2 (95% over 21bp) GGTACACTCAAGAAGGATCATCATAATCGTATGCCGTCTTCTGCTT 22481 0.4664764047722895 Illumina Single End Adapter 1 (95% over 21bp) GGTACGAAATGGAAGGCCATCATAATCGTATGCCGTCTTCTGCTTG 21503 0.4461830938044812 Illumina Single End Adapter 1 (95% over 22bp) CAAAAGAAACTTAAAATCATCATAATCGTATGCCGTCTTCTGCTTG 21394 0.4439213648724862 Illumina Single End Adapter 1 (95% over 22bp) GCGTAGAAGACATCACAACATCATAATCGTATGCCGTCTTCTGCTT 20473 0.4248107928874642 Illumina Single End Adapter 2 (95% over 21bp) GTGGTATTTATTTTCGACATCATAATCGTATGCCGTCTTCTGCTTG 19728 0.40935218688437913 Illumina Single End Adapter 2 (95% over 22bp) TAAAAATGGAAAAAAAACATCATAATCGTATGCCGTCTTCTGCTTG 19107 0.3964665569140224 Illumina Single End Adapter 1 (95% over 22bp) CACAAAGACAATAAAGTTCATCATAATCGTATGCCGTCTTCTGCTT 18616 0.3862784018166871 Illumina Single End Adapter 1 (95% over 21bp) CCTGTACAGAAACAAACCATCATAATCGTATGCCGTCTTCTGCTTG 18389 0.38156819569225714 Illumina Single End Adapter 2 (95% over 22bp) GTAAATATTTTCAAGGTCATCATAATCGTATGCCGTCTTCTGCTTG 17817 0.3696993062509623 Illumina Paired End PCR Primer 2 (95% over 22bp) CACGCAAATTCGGACCCCATCATAATCGTATGCCGTCTTCTGCTTG 17242 0.3577681673895208 Illumina Single End Adapter 1 (95% over 22bp) TTGGCTTCACCAACAACCATCATAATCGTATGCCGTCTTCTGCTTG 16580 0.3440317953438264 Illumina PCR Primer Index 1 (95% over 22bp) TAATGATAGAAAAAATACATCATAATCGTATGCCGTCTTCTGCTTG 16508 0.34253780926030675 Illumina Paired End PCR Primer 2 (95% over 22bp) CTAATTGTGATATAAATACATCATAATCGTATGCCGTCTTCTGCTT 16443 0.34118907182379593 Illumina Paired End PCR Primer 2 (95% over 21bp) TATTGTAGCTAGTCATCTCATCATAATCGTATGCCGTCTTCTGCTT 16357 0.3394045884462586 Illumina Single End Adapter 2 (95% over 21bp) AACAATTCCTTCATTAGCATCATAATCGTATGCCGTCTTCTGCTTG 15637 0.32446472761106226 Illumina Paired End PCR Primer 2 (95% over 22bp)

fastqc rna-seq qc sage trimmomatic • 187 views
ADD COMMENTlink written 6 weeks ago by hasche890

I suggest you trim adapters as indicated at the top of this thread.

ADD REPLYlink written 6 weeks ago by Brian Bushnell9.0k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1228 users visited in the last hour