smallRNA - adaptor trimming stringency
0
0
Entering edit mode
4.8 years ago
ti&te ▴ 20

Dear all,

I am trying to analyze my smallRNA seq data and before alignment it is recommended to trim sequenced reads. What stringency for trimming adaptors do you use in your experiments? I have tried with 0.7 and 0.95 adaptor trimming stringency and I got very different results that differ in proportion of mature RNA and iso-miRNA . Any suggestion?

Thank you for your help...

RNA-Seq adaptors smallRNA trimming stringency • 1.4k views
ADD COMMENT
0
Entering edit mode

Please show us what commands did you use and adapter sequences used ? How does the length distribution of reads look after trimming adapters.

ADD REPLY
0
Entering edit mode

We use Basespace trimmer app - FASTQ Toolkit. RNA libraries were prepared using NEB smallRNA library preparation kit, where 3' adaptor sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and 5' adaptor GTTCAGAGTTCTACAGTCCGACGATC.

Pic of trimmed seq distribution: enter image description here

ADD REPLY

Login before adding your answer.

Traffic: 2521 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6