Question: smallRNA - adaptor trimming stringency
0
gravatar for ti&te
2.6 years ago by
ti&te10
ti&te10 wrote:

Dear all,

I am trying to analyze my smallRNA seq data and before alignment it is recommended to trim sequenced reads. What stringency for trimming adaptors do you use in your experiments? I have tried with 0.7 and 0.95 adaptor trimming stringency and I got very different results that differ in proportion of mature RNA and iso-miRNA . Any suggestion?

Thank you for your help...

ADD COMMENTlink modified 2.5 years ago by Biostar ♦♦ 20 • written 2.6 years ago by ti&te10

Please show us what commands did you use and adapter sequences used ? How does the length distribution of reads look after trimming adapters.

ADD REPLYlink written 2.6 years ago by Chirag Nepal2.2k

We use Basespace trimmer app - FASTQ Toolkit. RNA libraries were prepared using NEB smallRNA library preparation kit, where 3' adaptor sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and 5' adaptor GTTCAGAGTTCTACAGTCCGACGATC.

Pic of trimmed seq distribution: enter image description here

ADD REPLYlink written 2.6 years ago by ti&te10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1831 users visited in the last hour