smallRNA - adaptor trimming stringency
Entering edit mode
5.7 years ago
ti&te ▴ 40

Dear all,

I am trying to analyze my smallRNA seq data and before alignment it is recommended to trim sequenced reads. What stringency for trimming adaptors do you use in your experiments? I have tried with 0.7 and 0.95 adaptor trimming stringency and I got very different results that differ in proportion of mature RNA and iso-miRNA . Any suggestion?

Thank you for your help...

RNA-Seq adaptors smallRNA trimming stringency • 1.6k views
Entering edit mode

Please show us what commands did you use and adapter sequences used ? How does the length distribution of reads look after trimming adapters.

Entering edit mode

We use Basespace trimmer app - FASTQ Toolkit. RNA libraries were prepared using NEB smallRNA library preparation kit, where 3' adaptor sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and 5' adaptor GTTCAGAGTTCTACAGTCCGACGATC.

Pic of trimmed seq distribution: enter image description here


Login before adding your answer.

Traffic: 943 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6