Question: Upstream Primer and Restriction Sites
0
gravatar for MolecularBiologyStudent
16 months ago by

I would like to use PCR to amplify just the coding sequence of a gene. I would also like to add an EcoR1 restriction site upstream of the start codon of the ORF. How can I find the upstream primer? Where is the start codon? And where would the EcoR1 restriction site be located?

The primers I plan to use are:

T T A A A G G C A A C A G C G C G A A C

T A G C G A A G G C G T A T T T T G C G

Below is the nucleic acid sequence for the gene of interest.

GAATATAGCTTTCCGACCCTGAAAGAAATTACCGGCAGCCTGGTGATTTATTATGTGAAA GGCACCAAAACCCTGGGCCTGTATTTTCCGAACCTGACCATTATTCGCGGCCAGACCCTG GCGTATAACTATGCGGTGGTGATTAAAGAAACCAACCTGCTGGTGATTAACCTGTTTCAG TATATTGGCCTGGTGAACCTGCGCCTGGTGATGTTTGGCGGCGTGCGCATTGATAACAAC CCGAGCCTGTGCTATGTGAACACCATTAACTGGACCAGCATTGTGCGCCAGCATGGCGCG CCGATTAAACTGATTAACATGCGCAACTTTTGCCTGGAATTTTGCCCGAACAACTGCCCG CGCGGCGAAAACCTGCAGAAATATTGCTGGCATCATAACACCTGCCAGAACGTGTGCAGC GAAAGCTGCGCGAAAAACAACCAGTATTGCTTTATGAACGATCCGAACCGCTGCTGCCAT CCGGAATGCCTGGGCGGCTGCTATGGCGAAGGCGATGAAATGTGCGTGAGCTGCAAAAAC GTGCTGAGCAACGGCCGCTGCGTGAAAAAATGCGATAAATTTTTTTATAAATATAAAAAC CGCCGCTGCATTAGCGAAAGCGAATGCATGAACCTGAGCAGCCAGAGCAGCACCGATTAT CGCCGCGAAGATCATTATGCGATTGAAGATGATGCGTGCGTGAAACAGTGCAGCCCGGGC AAACAGCAGAACAAAATTACCGGCCGCTGCGAAATTTGCGGCAGCGAATGCAGCAAAAAA TATTGCGGCCGCGTGCTGATTCATAGCATTAACGATTTTAGCGAAGCGGAAGGCTGCTAT AGCATTGAAGATATTTATATTAGCATTAAAGAAGGCGGCAGCAGCCTGAGCGATATTCTG ATGAAAGCGTTTAGCAAACTGACCATTATTGAAAACAGCCTGCGCATTGTGAAAAGCAGC AGCATTACCAGCCTGGATTTTCTGCGCAGCCTGCGCATTATTAAAGGCAACAGCGCGAAC AAAAACAACAACGAAACCACCAACGGCAGCAACAAAAGCATTGTGTTTGAAGTGTATGAT AACGAAAACCTGGTGGAAATTTTTGATGAAAAAGTGGCGCTGAACCAGCTGAACATTACC ATTCTGGAAGGCAGCGTGAGCTTTAACCTGAACCGCAAACTGTGCCCGGAAAAAATTCTG AGCTTTCTGAACAGCAACGTGCAGACCAAAACCAAACTGAGCAAACTGGATGAACGCATT ATTAACGTGAGCAACGGCGATATGGCGTTTTGCAAACATGAAAAACTGATTGTGCAGGTG CTGAACATTAGCGATAGCAGCTTTACCGTGAAATGCCATAGCAAAGTGCCGGATATTAGC CTGCAGAACAGCGCGCTGACCGCGCTGTTTATGCTGAAAGAAACCACCAAAAACGTGAGC CAGTATGAACTGTTTAACAGCTGCAGCGAACAGAACTGGCGCACCGTGGAAGGCTATATT GGCAAACCGGTGGTGATTGATAACCTGCTGCCGGCGAAACGCTATGCGTTTTATGCGGAA GCGATTCGCAGCCGCGTGGAAAACTGGCTGGAAATTAGCGATGTGATTTATCTGACCACC GAACGCAAAAACCCGAGCCAGCCGATTAACCTGAAAACCGAAACCCTGAGCAGCAGCGAA ATTCGCCTGACCTGGAACCCGCCGCTGTTTCCGAACGGCGAAGTGACCCGCTATATTATT TGGTATCGCAGCCTGGAAATTTTTGGCGATGATTTTTTTATGGAAGATGTGTGCTTTACC AAAAGCAAAAGCCAGCGCCGCATTCAGAGCCAGAGCAACAACCGCATTAGCAAAACCAAC AACGGCAACCAGAACCAGGGCGAATGCGATTGCGATAAATGCATGGAAAGCTGCAACAAA AACCAGATTCTGATTAACATTGATAAAGATGATACCATTATGCAGTTTCTGGATGAATAT ATTACCAAAAGCTTTATTAAACAGAACGAAATTCCGAAAAGCAACTGGAAACCGGTGGAT AGCGGCCATTTTGAAATTAAAAAAGTGGAATATAACCAGACCGTGCGCGTGGATGAAGTG GTGACCAACCTGCCGGCGACCGATATTAGCACCATTAGCAAACCGAGCATTGAAAACCTG ACCAACCATTTTAAAAAAATGGTGCAGGTGCCGGCGAACGAAACCTATTTTAAATTTACC AACCTGCATCATTATACCGAATATTTTTTTGAAATTCAGGCGTGCCAGGATCTGCAGAAC GTGCAGAGCAGCGAAAGCAAAGCGCTGAGCAAAAACGGCACCAGCAAAAACGTGCTGAAC CTGCCGTGCAGCAGCAAAAGCCTGATTAGCGCGCATACCAGCCCGAAAGAAAACATGGAT AACATTAACGAAAGCACCATTAACACCCGCGTGAACGGCAGCAGCGTGAAAATTTTTTGG AGCGAACCGAAAAGCCCGAACGGCTTTATTCTGAACTATTTTATTCGCTATCGCAAATAT CCGTATGAAGCGGAACTGGATTGGCTGAGCACCCCGTGCGTGACCCGCCCGGAATGGCTG AACGGCACCAACATTATGGCGAAAAACAGCAGCAACAGCACCAACATTATTCAGCAGAAA AGCGGCTTTTATACCCTGCGCGATCTGAAACCGGGCAAATATGAATTTCAGATTAAACCG TTTGCGATTGCGACCGAAGGCGCGTGGACCAAAAGCTATCATTTTAAAATTAGCAGCGAT AGCATTTTTACCGAATATCGCAACTATTTTATTATTGGCGCGGTGGTGATTATTATTATT CTGTGCGCGCTGTTTGTGCTGGTGTGCTATTATTGCAAAAAAAAATATCTGGAACGCACC CGCTGGGTGAGCAGCAACCCGGATTATTGGATTATTTATGAAATTGATGTGTGGGAAATT GATCGCAAAGATGTGGATATGCTGGAATGGAACTATCCGCTGGGCCGCGGCAGCTTTGGC ATGGTGTATAAAGGCGTGCTGAAAAACCTGACCACCCCGGCGCGCGATAAATATCTGCGC ACCCTGGATGAAAAACAGATGTTTGTGGCGGTGAAAACCCTGAACACCAACAGCACCATT CTGGAACGCCGCGAATTTATTAACGAAGCGTGCTATATGAAACAGTTTCAGAGCTATCAT CTGGTGAAACTGTATGGCATTGTGAGCAAA

pcr primer ecori codon orf • 529 views
ADD COMMENTlink written 16 months ago by MolecularBiologyStudent20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 922 users visited in the last hour