bowtie2 paired end read alignment yieldsscaffold information for unmapped reads
0
0
Entering edit mode
3.4 years ago
al.bodrug ▴ 50

The command I used:

bowtie2 --fr -p 30 -x $GENOME -I 200 -X 800 -1 $READ1 -2 READ2 -S $SAM

I wanted to extract unmapped reads. When using samtools view -f0x4 I obtain unmapped pairs and pairs where one of the mates is mapped and the other is not mapped. In the latter case, both mates have a scaffold assignment. Second line, 69 flag --> read itself is unaligned.Looks like this is normal behavior however it is not intuitive at all.

7001253F:534:CBPYUANXX:1:1106:1173:2204#GTGAAA  137     scaffold1402    100976  42      43M     =       100976  0       CTAGATTTTGACGATGGGAAAAGGAAAAAAATAAAGAAAAGAT     B<BB/F<FFFFFF/FFFFFFFFFFFBFFFFFBBBB<
7001253F:534:CBPYUANXX:1:1106:1173:2204#GTGAAA  69      scaffold1402    100976  0       *       =       100976  0       AACGTATTATACATATATATTATATATATATATGTGTATGTGTATATATATATATATATATATATAATGTTCTATACATAGAAC

My question is: Do you know why this is done? Is this a bug?

bowtie2 read alignment tlen unmapped • 818 views
ADD COMMENT

Login before adding your answer.

Traffic: 1888 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6