Question: bowtie2 paired end read alignment yieldsscaffold information for unmapped reads
0
gravatar for al.bodrug
22 months ago by
al.bodrug50
France
al.bodrug50 wrote:

The command I used:

bowtie2 --fr -p 30 -x $GENOME -I 200 -X 800 -1 $READ1 -2 READ2 -S $SAM

I wanted to extract unmapped reads. When using samtools view -f0x4 I obtain unmapped pairs and pairs where one of the mates is mapped and the other is not mapped. In the latter case, both mates have a scaffold assignment. Second line, 69 flag --> read itself is unaligned.Looks like this is normal behavior however it is not intuitive at all.

7001253F:534:CBPYUANXX:1:1106:1173:2204#GTGAAA  137     scaffold1402    100976  42      43M     =       100976  0       CTAGATTTTGACGATGGGAAAAGGAAAAAAATAAAGAAAAGAT     B<BB/F<FFFFFF/FFFFFFFFFFFBFFFFFBBBB<
7001253F:534:CBPYUANXX:1:1106:1173:2204#GTGAAA  69      scaffold1402    100976  0       *       =       100976  0       AACGTATTATACATATATATTATATATATATATGTGTATGTGTATATATATATATATATATATATAATGTTCTATACATAGAAC

My question is: Do you know why this is done? Is this a bug?

ADD COMMENTlink modified 21 months ago by Biostar ♦♦ 20 • written 22 months ago by al.bodrug50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1449 users visited in the last hour