Entering edit mode
6.1 years ago
Rajesh Detroja
▴
220
Dear All,
I have a 63bp of reference sequences as follows:
>M17541
GATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGAC
TTT
And I have a 75bp paired-end sequencing data!
75bp of sequencing reads contains only the 22bp of the reference sequence as follows: CATGGAGACGCAGAAGCCCTTC
My question is that, How to perform a mapping between only these region using BWA or Bowtie2!
However, I have already tried the Bowtie2 with --local option and BWA with small seed length but it's not working!
Also, I have tried by masking other region of the reference sequence with 'N', but it's not working too!
Thanks!