Question: Mapping of long read to extremely small reference sequence
0
gravatar for Rajesh Detroja
16 months ago by
INDIA
Rajesh Detroja130 wrote:

Dear All,

I have a 63bp of reference sequences as follows:

>M17541
GATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGAC
TTT

And I have a 75bp paired-end sequencing data!

75bp of sequencing reads contains only the 22bp of the reference sequence as follows: CATGGAGACGCAGAAGCCCTTC

My question is that, How to perform a mapping between only these region using BWA or Bowtie2!

However, I have already tried the Bowtie2 with --local option and BWA with small seed length but it's not working!

Also, I have tried by masking other region of the reference sequence with 'N', but it's not working too!

Thanks!

ADD COMMENTlink modified 15 months ago • written 16 months ago by Rajesh Detroja130
0
gravatar for Rajesh Detroja
15 months ago by
INDIA
Rajesh Detroja130 wrote:

SOLVED!

Reference: Local alignment using STAR

ADD COMMENTlink modified 15 months ago • written 15 months ago by Rajesh Detroja130
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2090 users visited in the last hour