*.misa and *.statistic file differ in the identified ssr.
1
0
Entering edit mode
15 months ago

*.misa and *.statistic file differ in the identified ssr. The number of identified SSRs in *.statistic file is 216 but *.misa shows the detail of only 171 SSRs only. I have tried online and offline misa both but the result is same. Please suggest why is it so?? Which file to consider for the results in this case?

SSR MISA • 511 views
ADD COMMENT
2
Entering edit mode
15 months ago
Tm ★ 1.0k

What you are getting in .statistics and .misa is correct.

Number of SSRs in detail file are equal to following:

Total number of identified SSRs - Number of SSRs present in compound formation

See here for example:

Total number of sequences examined  740501
Total size of examined sequences (bp)   : 52204953
Total number of identified SSRs : 5595
Number of SSR containing sequences  : 4979
Number of sequences containing more than 1 SSR  : 530
Number of SSRs present in compound formation    : 320

So number of SSRs in my detail file will be 5595-320 = 5275

This happens as SSRs in compound formation are represented as (SSR)normal_sequence(SSR) as 2 SSRs are in single line:

For example:

(CCG)5ctcgcgcccgcgcccgcaaccaagaggaag(GCC)5

Thus in your case, number of SSRs in compound formation should be: 45

ADD COMMENT
0
Entering edit mode

thank you @toralmanvar for explaining in detail. But still have a doubt if we have to report number of ssr on basis of repeat type (for e.g. monomer-147, dimer-49) or abundance of SSR (like A/T- 120), so from where should I report .statistic file or by counting from detail .misa file.

ADD REPLY
1
Entering edit mode

That depends on your aim. However, you can always report whatever is obtained in .statistics file.

ADD REPLY
0
Entering edit mode

thank you for your valuable suggestions.

ADD REPLY

Login before adding your answer.

Traffic: 1972 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6