Entering edit mode
4.9 years ago
celebiration8
▴
10
Hello, I'm using RNAplex combining with RNAplfold to detect possible binding sites for two RNAs "target.fa" and "query.fa":
target.fa:
>target
CAGCTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAACCAA
query.fa:
>query
cagatttatcgattgacacccagtatt
Firstly I used RNAplfold to generate _openen files for each RNA:
RNAplfold -u 27 -O < target.fa
RNAplfold -u 27 -O < query.fa
Everything's fine until I apply the -e option (energy threshold) of RNAplex:
$ RNAplex -q query.fa -t target.fa -a ./ -l 27 -e -4
>target
>query
Error during initialization of the duplex in duplexfold_XS
Error during initialization of the duplex in duplexfold_XS
((((((......(&)....)))))) 21,33 : 10,20 (-4.83 = -8.95 + 3.26 + 0.86) i:33,j:10 <-5.35>
Error during initialization of the duplex in duplexfold_XS
Error during initialization of the duplex in duplexfold_XS
((((((.(&))))))) 21,28 : 14,20 (-4.21 = -8.17 + 3.16 + 0.80) i:28,j:14 <-4.94>
Error during initialization of the duplex in duplexfold_XS
((((((&)))))) 22,27 : 16,21 (-7.97 = -10.95 + 2.28 + 0.70) i:27,j:16 <-8.20>
While the optimal interaction is always properly calculated, the majority of suboptimals encounter error. Anyone has ideas about this? Thanks!