Error using RNAplex & RNAplfold while applying energy threshold

Question

[celebiration8]

Hello, I'm using RNAplex combining with RNAplfold to detect possible binding sites for two RNAs "target.fa" and "query.fa":

target.fa:

>target
CAGCTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAACCAA

query.fa:

>query
cagatttatcgattgacacccagtatt

Firstly I used RNAplfold to generate _openen files for each RNA:

RNAplfold -u 27 -O < target.fa
RNAplfold -u 27 -O < query.fa

Everything's fine until I apply the -e option (energy threshold) of RNAplex:

$ RNAplex -q query.fa -t target.fa -a ./ -l 27 -e -4
>target
>query
Error during initialization of the duplex in duplexfold_XS
Error during initialization of the duplex in duplexfold_XS
((((((......(&)....))))))  21,33  :  10,20  (-4.83 = -8.95 +  3.26 +  0.86) i:33,j:10 <-5.35>
Error during initialization of the duplex in duplexfold_XS
Error during initialization of the duplex in duplexfold_XS
((((((.(&)))))))  21,28  :  14,20  (-4.21 = -8.17 +  3.16 +  0.80) i:28,j:14 <-4.94>
Error during initialization of the duplex in duplexfold_XS
((((((&))))))  22,27  :  16,21  (-7.97 = -10.95 +  2.28 +  0.70) i:27,j:16 <-8.20>

While the optimal interaction is always properly calculated, the majority of suboptimals encounter error. Anyone has ideas about this? Thanks!