Off topic:How To Create Dot-Bracket Annotation For Rna With Pseudoknots
1
1
Entering edit mode
14.2 years ago
Niklas ▴ 60

Dear all,

I am trying to figure out a way of creating a Dot-Bracket structure for an RNA with arbitrary pseudoknots. The input data is a list of base pairs like this one:

5 17
6 16
7 15
10 20
11 19

The output should look like this:

....(((..[[...))).]]
AUGUACCGUCCUUUUGGAGG

Since there is no restriction on the pseudoknots there could also be a base pair 12 30 which would need a different set of brackets, e.g. { }.

Does anyone know an effective way of doing this? Any help would be appreciated!

Regards Nick

rna secondary • 4.3k views
ADD COMMENT
This thread is not open. No new answers may be added
Traffic: 3694 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6