Question: Same Sample, Same Locus, 2 Different Insertions Called By Pindel
gravatar for prachi2808
4.1 years ago by
prachi28080 wrote:


Pindel 0.2.5a1 called the following 2 insertions, in a tumor sample, at the same locus.

7480    I 3    NT 3 "TAA"    ChrID chrY    BP 13506676    13506677    BP_range 13506676    13506677    Supports 8    7    + 8    7    - 0    0S1 9    SUM_MS 149    1    NumSupSamples 1    1    default 0 0 8 7 0 0
                                              GGGCAAACAATTAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAAAAGCAAGCATTTTA        +    13506449    17    default    @HWI-ST824:289:D18GCACXX:1:1303:15833:87741
                                             GGGGCAAACAATTAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAAAAGCAAGCATTTT         +    13506537    18    default    @HWI-ST824:289:D18GCACXX:1:1204:5502:40808
                                        CTGTAGGGGCAAACAATTAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAAAAGCAAGC              +    13506467    17    default    @HWI-ST824:289:D18GCACXX:1:1206:19866:98908
                                   ACCACCTGTAGGGGCAAACAATTAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAAAAG                   +    13506546    18    default    @HWI-ST824:289:D18GCACXX:1:2107:14168:43504
                                CATACCACCTGTAGGGGCAAACAATTAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAA                      +    13506528    17    default    @HWI-ST824:289:D18GCACXX:1:1106:2774:116744
   TTCCTTACAGAGGCTATGGCGTTATTAAGCATACCACCTGTAGGGGCAAACAATTAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAG                                                   +    13506496    16    default    @HWI-ST824:289:D18GCACXX:1:1101:7766:191790

7481    I 4    NT 4 "AAAA"    ChrID chrY    BP 13506676    13506677    BP_range 13506676    13506684    Supports 4    2    + 4    2    - 0    0S1 5    SUM_MS 59    1    NumSupSamples 1    1    default 0 0 4 2 0 0
                                                  GCAAACAATTAAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAAAAGCAAGCATTTTAT       +     13506511    14    default    @HWI-ST824:289:D18GCACXX:1:2204:7803:89852
                                                 GGCAAACAATTAAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCAGAAAAGCAAATCTAGGTGGTTCATGAAGAAAAGCAAGCATTTTA        +     13506464    23    default    @HWI-ST824:289:D18GCACXX:1:1307:14920:58485
     TTCCTTACAGAGGCTATGGCGTTATTAAGCATACCACCTGTAGGGGCAAACAATTAAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCA                                                    +     13506451    12    default    @HWI-ST824:289:D18GCACXX:1:1307:18878:91213
     TTCCTTACAGAGGCTATGGCGTTATTAAGCATACCACCTGTAGGGGCAAACAATTAAAAAAAAAAATCACAAAGAAATATTTTCACATACACTACACATCA                                                    +     13506451    10    default    @HWI-ST824:289:D18GCACXX:1:1302:12242:14081

Are these kinds of calls (same locus, different calls) to be treated with caution, or are these valid calls?

Additionally, shouldn't the second call be a TAAA call rather than an AAAA call?

Thanks, Prachi

pindel • 844 views
ADD COMMENTlink modified 4.1 years ago by liangkaiye250 • written 4.1 years ago by prachi28080
gravatar for liangkaiye
4.1 years ago by
United States
liangkaiye250 wrote:

these two calls are related to homopolymer and probably they are all true ones but being somatic at different frequencies. the second one indeed should be TAAA. have you seen more cases like this? pindel leftshifts breakpoints and this one seems an error.


ADD COMMENTlink written 4.1 years ago by liangkaiye250
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1286 users visited in the last hour