Question: Looking For A Description Of The Output Format Generated By Rnafold
0
gravatar for biolab
5.6 years ago by
biolab1.1k
biolab1.1k wrote:

Hi everyone,

I used RNAfold to predict RNA second structure. I need to calculate the number of foldbacks for each position, which is a critical parameter ot assess RNA second structure. I got a Ct format file like below.

169 ENERGY =   -80.3    1
    1 G       0    2    0    1
    2 G       1    3    0    2
    3 A       2    4  167    3
    4 A       3    5  166    4
    5 A       4    6  165    5
.........

The first column is position. Can someone inform me what the other 4 columns represent? In addition the thermodynamic feature for this RNA is as follows. I need to make statistics of each site's entropy value. Are those values listed at the last column entropy values? I saw a reference uses bits as the unit of entropy. How to calculate entropy?

External loop                           :   -30

Interior loop (  3,167) AU; (  4,166) AU:   -90

Interior loop (  4,166) AU; (  5,165) AU:   -90

Interior loop (  5,165) AU; (  6,164) GC:  -210

Interior loop (  6,164) GC; (  9,161) UA:     0
.........................

Hairpin  loop ( 81, 87) CG              :   430

GGAAAGGCUUUGUAAAACACACUAUUUGACAGUUUGGAAAGCGUGCUCACGGAAAACGAGGGAGCAGCCAAGGCAUUGUUCUUACCGGUUUAUGAAUUGGCUACUUCCUCGUUUUCCGUAAACACGCUUCCCGAGCUUCUAAACGGUGUGUUUCUUGCAAAAACUUUAU

..((((..(((((((((((((((.((((..(((((((.(((((((...((((((((((((((((.((((((..(((...((.....))...)))..)))))).))))))))))))))))...))))))).)))))))..)))).))))))))..)))))))..)))).. (-80.30)

THANK YOU VERY MUCH!

• 1.9k views
ADD COMMENTlink modified 5.6 years ago by PoGibas4.8k • written 5.6 years ago by biolab1.1k

Can you please change question title to something more descriptive?

ADD REPLYlink modified 5.6 years ago • written 5.6 years ago by PoGibas4.8k

Thank you very much. Next time i will use more descriptive titles.

ADD REPLYlink written 5.6 years ago by biolab1.1k

"I need to make statistics of each site's entropy value" - This is different question. And what do you mean by "site" and "statistics"?

ADD REPLYlink modified 5.6 years ago • written 5.6 years ago by PoGibas4.8k

sorry for my English. actually i mean to get each site's entropy value (this value outputed by RNAfold) for a given miRNA. Next step i need to make statistics of each site's entropy value for many miRNAs. It's much likely the stem and hairpin differs significantly. THANKS!

ADD REPLYlink written 5.6 years ago by biolab1.1k
1
gravatar for PoGibas
5.6 years ago by
PoGibas4.8k
Vilnius
PoGibas4.8k wrote:

CT (Connectivity Table) file format info can be found here.

Each of the following lines provides information about a given base in the sequence. Each base has its own line, with these elements in order:
- Base number: index n
- Base (A, C, G, T, U, X)
- Index n-1
- Index n+1
- Number of the base to which n is paired. No pairing is indicated by 0 (zero)
- Natural numbering. RNAstructure ignores the actual value given in natural numbering, so it is easiest to repeat n here

ADD COMMENTlink modified 5.6 years ago • written 5.6 years ago by PoGibas4.8k

Really helpful. THANKS!

ADD REPLYlink written 5.6 years ago by biolab1.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1587 users visited in the last hour