Looking For A Description Of The Output Format Generated By Rnafold

Question

[biolab]

Hi everyone,

I used RNAfold to predict RNA second structure. I need to calculate the number of foldbacks for each position, which is a critical parameter ot assess RNA second structure. I got a Ct format file like below.

169 ENERGY =   -80.3    1
    1 G       0    2    0    1
    2 G       1    3    0    2
    3 A       2    4  167    3
    4 A       3    5  166    4
    5 A       4    6  165    5
.........

The first column is position. Can someone inform me what the other 4 columns represent? In addition the thermodynamic feature for this RNA is as follows. I need to make statistics of each site's entropy value. Are those values listed at the last column entropy values? I saw a reference uses bits as the unit of entropy. How to calculate entropy?

External loop                           :   -30

Interior loop (  3,167) AU; (  4,166) AU:   -90

Interior loop (  4,166) AU; (  5,165) AU:   -90

Interior loop (  5,165) AU; (  6,164) GC:  -210

Interior loop (  6,164) GC; (  9,161) UA:     0
.........................

Hairpin  loop ( 81, 87) CG              :   430

GGAAAGGCUUUGUAAAACACACUAUUUGACAGUUUGGAAAGCGUGCUCACGGAAAACGAGGGAGCAGCCAAGGCAUUGUUCUUACCGGUUUAUGAAUUGGCUACUUCCUCGUUUUCCGUAAACACGCUUCCCGAGCUUCUAAACGGUGUGUUUCUUGCAAAAACUUUAU

..((((..(((((((((((((((.((((..(((((((.(((((((...((((((((((((((((.((((((..(((...((.....))...)))..)))))).))))))))))))))))...))))))).)))))))..)))).))))))))..)))))))..)))).. (-80.30)

THANK YOU VERY MUCH!

[PoGibas]

Can you please change question title to something more descriptive?

[biolab]

Thank you very much. Next time i will use more descriptive titles.

[PoGibas]

"I need to make statistics of each site's entropy value" - This is different question. And what do you mean by "site" and "statistics"?

[biolab]

sorry for my English. actually i mean to get each site's entropy value (this value outputed by RNAfold) for a given miRNA. Next step i need to make statistics of each site's entropy value for many miRNAs. It's much likely the stem and hairpin differs significantly. THANKS!

Answer 1

[PoGibas]

CT (Connectivity Table) file format info can be found here.

Each of the following lines provides information about a given base in the sequence. Each base has its own line, with these elements in order:
- Base number: index n
- Base (A, C, G, T, U, X)
- Index n-1
- Index n+1
- Number of the base to which n is paired. No pairing is indicated by 0 (zero)
- Natural numbering. RNAstructure ignores the actual value given in natural numbering, so it is easiest to repeat n here

[biolab]

Really helpful. THANKS!